Proteomic analysis reveals USP7 as a novel regulator of palmitic acid-induced hepatocellular carcinoma cell death

Nutrient surplus and consequent free fatty acid accumulation in the liver cause hepatosteatosis. The exposure of free fatty acids to cultured hepatocyte and hepatocellular carcinoma cell lines induces cellular stress, organelle adaptation, and subsequent cell death. Despite many studies, the mechanism associated with lipotoxicity and subsequent cell death still remains poorly understood. Here, we have used the proteomics approach to circumvent the mechanism for lipotoxicity using hepatocellular carcinoma cells as a model. Our quantitative proteomics data revealed that ectopic lipids accumulation in cells severely affects the ubiquitin-proteasomal system. The palmitic acid (PA) partially lowered the expression of deubiquitinating enzyme USP7 which subsequently destabilizes p53 and promotes mitotic entry of cells. Our global phosphoproteomics analysis also provides strong evidence of an altered cell cycle checkpoint proteins’ expression that abrogates early G2/M checkpoints recovery with damaged DNA and induced mitotic catastrophe leading to hepatocyte death. We observe that palmitic acid prefers apoptosis-inducing factor (AIF) mediated cell death by depolarizing mitochondria and translocating AIF to the nucleus. In summary, the present study provides evidence of PA-induced hepatocellular death mediated by deubiquitinase USP7 downregulation and subsequent mitotic catastrophe.Subject terms: Apoptosis, Protein-protein interaction networks     

Molecular recognition of a model globular protein apomyoglobin by synthetic receptor cyclodextrin: effect of fluorescence modification of the protein and cavity size of the receptor in the interaction

Labelling of proteins with some extrinsic probe is unavoidable in molecular biology research. Particularly, spectroscopic studies in the optical region require fluorescence modification of native proteins by attaching polycyclic aromatic fluoroprobe with the proteins under investigation. Our present study aims to address the consequence of the attachment of a fluoroprobe at the protein surface in the molecular recognition of the protein by selectively small model receptor. A spectroscopic study involving apomyoglobin (Apo‐Mb) and cyclodextrin (CyD) of various cavity sizes as model globular protein and synthetic receptors, respectively, using steady‐state and picosecond‐resolved techniques, is detailed here. A study involving Förster resonance energy transfer, between intrinsic amino acid tryptophan (donor) and N, N‐dimethyl naphthalene moiety of the extrinsic dansyl probes at the surface of Apo‐Mb, precisely monitor changes in donor acceptor distance as a consequence of interaction of the protein with CyD having different cavity sizes (β and γ variety). Molecular modelling studies on the interaction of tryptophan and dansyl probe with β‐CyD is reported here and found to be consistent with the experimental observations. In order to investigate structural aspects of the interacting protein, we have used circular dichroism spectroscopy. Temperature‐dependent circular dichroism studies explore the change in the secondary structure of Apo‐Mb in association with CyD, before and after fluorescence modification of the protein. Overall, the study well exemplifies approaches to protein recognition by CyD as a synthetic receptor and offers a cautionary note on the use of hydrophobic fluorescent labels for proteins in biochemical studies involving recognition of molecules. Copyright © 2013 John Wiley & Sons, Ltd.     

Bottleneck in the endangered kalibaus, Labeo calbasu (cyprinidae: cypriniformes) populations in Bangladesh revealed by microsatellite DNA marker analysis

Microsatellite DNA marker analysis was carried out to assess the population genetic structure of an endangered carp, Labeo calbasu, collected from three different stocks; the Jamuna River, the Halda River and a Hatchery. Four heterologous microsatellite loci (Lr12, Lr14b, Lr21 and Lr24) identified from rohu (Labeo rohita) were analyzed to test the genetic variability of the target kalibaus stocks. The maximum number of alleles observed in loci Lr12, Lr14b, Lr21 and Lr24 were 10, 7, 8 and 6, respectively. The loci were found to be polymorphic (<P ₉₅) in all the populations. The average number of allele was highest in the Jamuna population (6.75) followed by that of the Halda (5.50) and the Hatchery population (4.25). The observed average heterozygosity (Ho) value was almost similar in all three populations. Except locus Lr12 in the Halda population, significant deviations from the Hardy-Weinberg Equilibrium were detected in all cases due to excess heterozygosity. The population differentiation values (F _ST ) between all the population pairs were significant. The highest genetic distance value (D = 0.295) was measured between the Halda and the Hatchery populations. A recent bottleneck was observed in the Halda and the Hatchery population.     

Enhancement in Iron Absorption on Intake of Chemometrically Optimized Ratio of Probiotic Strain Lactobacillus plantarum 299v with Iron Supplement Pearl Millet

Biological Trace Element Research - This research article aims to establish the intake ratio of probiotic Lactobacillus plantarum 299v with iron supplement pearl millet by central composite design...     

Reproductive biology of Apocryptes bato (Gobiidae) in the Payra River,southern Bangladesh

The gobioid fish Apocryptes bato (Hamilton, 1822) is a species of mudskipper found in Bangladesh, India, and Myanmar. The reproductive biology of A. bato including sex ratio, size at sexual maturity, breeding season, fecundity, and condition factor was studied in the Payra River, southern Bangladesh during May 2016 to April 2017. A total of 1,028 specimens (303 males and 725 females) were collected. The overall sex ratio was significantly different from the expected value of 1:1 (male: female = 1:2.39, χ² = 173.23, p < 0.05). Size at sexual maturity was estimated as 4.9 cm standard length. Monthly variations in gonadosomatic index indicate that the main breeding season is from May to December. There was a significant positive correlation of body length and body weight with fecundity. Fulton's condition factor varied in both sexes and was attributed to variations in GSI with maturity. Breeding season was significantly associated with rainfall, but not air temperature. Our findings should improve management and conservation of this fish in the Payra River and surrounding ecosystems.     

Identification and characterization of the Arabidopsis gene encoding the tetrapyrrole biosynthesis enzyme uroporphyrinogen III synthase

UROS (uroporphyrinogen III synthase; EC 4.2.1.75) is the enzyme responsible for the formation of uroporphyrinogen III, the precursor of all cellular tetrapyrroles including haem, chlorophyll and bilins. Although UROS genes have been cloned from many organisms, the level of sequence conservation between them is low, making sequence similarity searches difficult. As an alternative approach to identify the UROS gene from plants, we used functional complementation, since this does not require conservation of primary sequence. A mutant of Saccharomyces cerevisiae was constructed in which the HEM4 gene encoding UROS was deleted. This mutant was transformed with an Arabidopsis thaliana cDNA library in a yeast expression vector and two colonies were obtained that could grow in the absence of haem. The rescuing plasmids encoded an ORF (open reading frame) of 321 amino acids which, when subcloned into an Escherichia coli expression vector, was able to complement an E. coli hemD mutant defective in UROS. Final proof that the ORF encoded UROS came from the fact that the recombinant protein expressed with an N-terminal histidine-tag was found to have UROS activity. Comparison of the sequence of AtUROS (A. thaliana UROS) with the human enzyme found that the seven invariant residues previously identified were conserved, including three shown to be important for enzyme activity. Furthermore, a structure-based homology search of the protein database with AtUROS identified the human crystal structure. AtUROS has an N-terminal extension compared with orthologues from other organisms, suggesting that this might act as a targeting sequence. The precursor protein of 34 kDa translated in vitro was imported into isolated chloroplasts and processed to the mature size of 29 kDa. Confocal microscopy of plant cells transiently expressing a fusion protein of AtUROS with GFP (green fluorescent protein) confirmed that AtUROS was targeted exclusively to chloroplasts in vivo.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Carbohydrate-dependent binding of the cell-free hemagglutinin of Vibrio cholerae to glycoprotein and glycolipid.

The carbohydrate-binding specificity of the cell-free hemagglutinin (HA) of Vibrio cholerae (K.K. Banerjee, A.N. Ghose, K. Datta-Roy, S.C. Pal, and A.C. Ghose, Infect. Immun.58:3698-3705, 1990) was studied by using glycoconjugates with defined sugar sequences. The HA was not inhibited by simple sugars including glucobiose, galabiose, and their N-acetylated derivatives. The hemagglutination of rabbit erythrocytes by the HA was inhibited moderately by fetuin, calf thyroglobulin, and human alpha 1-acid glycoprotein, all of which contain multiple asparagine-linked complex-type oligosaccharide units alone or in combination with serine/threonine-linked oligosaccharide units. The inhibitory potencies of the glycoproteins increased approximately 10-fold following removal of the terminal sialic acid and were completely destroyed by exhausative proteolysis. The HA agglutinated phosphatidylcholine liposomes containing GM1-ganglioside or its asialo-derivative in the presence of Ca2+ ions. The association constants of the complexes of the HA with asialofetuin, asialothyroglobulin, GM1-ganglioside, and asialo-GM1-ganglioside were determined by an enzyme-linked immunosorbent assay-based assay and found to be 1.7 x 10(7) M-1, 1.5 x 10(7) M-1, 1.8 x 10(7) M-1, and 2.4 x 10(7) M-1, respectively. Studies using chemically modified glycoproteins and plant lectins with defined sugar specificity revealed that the HA recognized the terminal beta 1-galactosyl moiety of these glycoconjugates. There was no evidence for the presence of an extended carbohydrate-binding domain in the HA molecule or a preference of the HA for a complex, branched oligosaccharide structure. Similar to the mechanisms proposed for the binding of cholera toxin and Shiga toxin to glycolipids and neoglycoproteins, the strong interaction of V. cholerae cell-free HA with glycoconjugates appeared to be a consequence of multiple weak binding to terminal beta1-galactosyl moieties of the glycoproteins or glycolipids.