G regulatory proteins and muscarinic receptor signal transduction in mucous acini of rat submandibular gland

The involvement of G regulatory proteins in muscarinic receptor signal transduction was examined in electrically permeabilized rat submandibular acinar cells. The guanine nucleotide analog, GTP gamma S, caused the dose dependent hydrolysis of membrane phosphatidylinositol 4,5-bisphosphate to release IP3. This response was insensitive to pertussis toxin treatment and was duplicated by NaF but not by GDP beta S. Enhanced IP3 synthesis was observed with a combination of GTP gamma S and carbachol. Exogenous IP3, as well as carbachol and GTP gamma S, provoked the release of sequestered 45Ca2+ from non-mitochondrial stores. In intact cells, carbachol significantly reduced the level of cyclic AMP induced by the beta-adrenergic agonist, isoproterenol, to 69% of its normal value. Pertussis toxin abolished this inhibitory action of carbachol on cyclic nucleotide levels. These results suggest that muscarinic receptors are coupled to two separate G regulatory proteins in submandibular mucous acini-the pertussis toxin-insensitive Gp of the phosphoinositide transduction pathway associated with elevated cytosolic calcium levels, and the pertussis toxin-sensitive Gi inhibitory protein of the adenylate cyclase complex.     

Genetic and radiation hybrid mapping of the hyperekplexia region on chromosome 5q.

Hyperekplexia, or startle disease (STHE), is an autosomal dominant neurologic disorder characterized by muscular rigidity of central nervous system origin, particularly in the neonatal period, and by an exaggerated startle response to sudden, unexpected acoustic or tactile stimuli. STHE responds dramatically to the benzodiazepine drug clonazepam, which acts at gamma-aminobutyric acid type A (GABA-A) receptors. The STHE locus (STHE) was recently assigned to chromosome 5q, on the basis of tight linkage to the colony-stimulating factor 1-receptor (CSF1-R) locus in a single large family. We performed linkage analysis in the original and three additional STHE pedigrees with eight chromosome 5q microsatellite markers and placed several of the most closely linked markers on an existing radiation hybrid (RH) map of the region. The results provide strong evidence for genetic locus homogeneity and assign STHE to a 5.9-cM interval defined by CSF1-R and D5S379, which are separated by an RH map distance of 74 centirays (roughly 2.2-3.7 Mb). Two polymorphic markers (D5S119 and D5S209) lie within this region, but they could not be ordered with respect to STHE. RH mapping eliminated the candidate genes GABRA1 and GABRG2, which encode GABA-A receptor components, by showing that they are telomeric to the target region.     

Primary structure of locust flight muscle fatty acid binding protein.

The amino acid sequence of the fatty acid binding protein (FABP) from flight muscle of the locust, Schistocerca gregaria, has been determined. The sequence of the N-terminal 39 amino acid residues, determined by automated Edman degradation, was used to prepare a degenerate oligonucleotide that corresponded to amino acid residues 16-23. cDNA coding for FABP was constructed from flight muscle mRNA and amplified by the polymerase chain reaction using the degenerate oligonucleotide and an oligo dT-NotI primer adapter as primers. The amplification product was cloned and sequenced. Additionally, a cDNA library of flight muscle mRNA was prepared and screened with a 414-bp probe prepared from the clone. The primary structure of locust FABP was compared with the proteins in the Swiss protein databank and found to have significant homology with mammalian FABPs over the entire 133-residue sequence. The best match was versus human heart FABP (41% identity), attesting to the highly conserved nature of this protein. The results suggest that locust muscle FABP is a member of the lipid binding protein superfamily and may provide valuable insight into the evolution of this abundant protein class.     

Regulation of expression of a wound-inducible tomato inhibitor I gene in transgenic nightshade plants

A wound-inducible proteinase Inhibitor I gene from tomato containing 725 bp of the 5 region and 2.5 kbp of the 3 region was stably incorporated into the genome of black nightshade plants (Solanum nigrum) using an Agrobacterium Ti plasmid-derived vector. Transgenic nightshade plants were selected that expressed the tomato Inhibitor I protein in leaf tissue. The leaves of the plants contained constitutive levels of the inhibitor protein of up to 60 g/g tissue. These levels increased by a factor of about two in response to severe wounding. Only leaves and petioles exhibited the presence of the inhibitor, indicating that the gene exhibited the same tissue specificity of expression found in situ in wounded tomato leaves. Inhibitor I was extracted from leaves of wounded transformed nightshade plants and was partially purified by affinity chromatography on a chymotrypsin-Sepharose column. The affinity-purified protein was identical to the native tomato Inhibitor I in its immunological reactivity and in its inhibitory activity against chymotrypsin. The protein exhibited the same M _r of 8 kDa as the native tomato Inhibitor I and its N-terminal amino acid sequence was identical to that of the native tomato inhibitor I, indicating that the protein was properly processed in nightshade plants. These expriments are the first report of the expression of a member of the wound-inducible tomato Inhibitor I gene family in transgenic plants. The results demonstrate that the gene contains elements that can be regulated in a wound-inducible, tissuespecific manner in nightshade plants.     

G Protein-mediated Activation of a Nonspecific Cation Current in Cultured Rat Retinal Pigment Epithelial Cells

We used whole-cell patch-clamp recording techniques to investigate G protein-activated currents in cultured rat retinal pigment epithelial (RPE) cells. Using 140 mm KCl intracellular and 130 mm NaCl extracellular solutions, rat RPE cells possessed both inward and outward K⁺ currents. Upon addition of the nonhydrolyzable guanine triphosphate analogue, guanosine-5′-O-(3-thiophosphate) (GTPγS, 0.1 mm), to the recording electrode, a nonspecific cation (NSC) current was elicited. The NSC current had a mean reversal potential of +5.7 mV in 130 mm extracellular NaCl with Cs⁺-aspartate in the pipette, and was not affected by alterations in the extracellular Ca²⁺ or Cl⁻ concentration. The GTPγS-activated current was found to be permeable to several monovalent cations (K⁺, Na⁺, choline, TRIS, and NMDG). Addition of fluoroaluminate, an activator of large molecular weight heterotrimeric GTP-binding proteins (G proteins), to the intracellular recording solution activated the NSC current. The G protein involved was pertussis toxin (PTX)-sensitive, since GTPγS failed to activate the NSC current in cells pretreated with PTX. Further investigation of second messenger molecules suggested that activation of the NSC current was not affected by alterations in intracellular Ca²⁺ or ATP. From these results, we conclude that a G protein-regulated NSC current is present in rat RPE cells. Activation of the NSC current may sufficiently depolarize RPE cells to activate outward K⁺ currents. This would provide a mechanism by which these cells could rid themselves of accumulated K⁺. Received: 25 January 1996/Revised: 24 April 1996     

Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats.

We have used reciprocal competition binding experiments with mutant substrates and chemical modification interference assays to precisely define the sequences within the adeno-associated virus (AAV) terminal repeat (TR) that are involved in site-specific binding to the AAV Rep protein. Mutagenesis experiments were done with a 43-bp oligonucleotide which contained the Rep binding element (RBE) within the A stem of the TR. Experiments in which two adjacent base pairs of the RBE were substituted simultaneously with nucleotides that produced transversions identified a 22-bp sequence (CAGTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity. Although the 22-bp RBE contains the GAGC motifs that have been found in all known Rep binding sites, our results suggest that the GAGC motifs alone are not the only sequences specifically recognized by Rep. The effects of substitutions within the 22-bp sequence were relatively symmetrical, with nucleotides at the periphery of the RBE having the least effect on binding affinity and those in the middle having the greatest effect. Dinucleotide mutations within 18 (GTGAGCGAGCGAGC) of the 22 bp were found to decrease the binding affinity by at least threefold. Dinucleotide mutations within a 10-bp core sequence (GCGAGCGAGC) were found to decrease binding affinity by more than 10-fold. Single-base substitutions within the 10-bp core sequence lowered the binding affinity by variable amounts (up to fivefold). The results of the mutagenesis analysis suggested that the A-stem RBE contains only a single Rep binding site rather than two or more independent sites. To confirm the results of the mutant analysis and to determine the relative contribution of each base to binding, chemical modification experiments using dimethyl sulfate and hydrazine were performed on both the linear A-stem sequence and the entire AAV TR in both the flip and flop hairpinned configurations. Interference assays on the linear A stem identified the 18-bp sequence described above as essential for binding. G, C, and T residues on both strands contributed to binding, and the interference pattern correlated well with the results of the mutagenesis experiments. Interference assays with complete hairpinned TR substrates also identified the 18-bp sequence as important for binding. However, the interference patterns on the two strands within the RBE and the relative contributions of the individual bases to binding were clearly different between the hairpinned substrates and the linear A-stem binding element. Interference assays also allowed us to search for residues within the small internal palindromes of the TR (B and C) that contribute to binding. The largest effect was seen by modification of two T residues within the sequence CTTTG. This sequence was present in the same position relative to the terminal resolution site (trs) in both the flip and flop orientations of the TR. In addition, the interference pattern suggested that the remaining bases within the CTTTG motif as well as other bases within the B and C palindromes make contacts with the Rep protein, albeit with lower affinities. Regardless of whether the TR was in the flip or flop orientation, most of the contact points were clustered in the small internal palindrome furthest away from the trs. We also determined the relative binding affinity of linear substrates containing a complete RBE with hairpinned substrates and found that linear substrates bound Rep less efficiently. Our results were consistent with our previous model that there are three distinct elements within the hairpinned AAV TR that contribute to binding affinity or to efficient nicking at the trs: the A-stem RBE, the secondary structure element which consists of the B and C palindromes, and the trs.     

Evidence for a correlation between ambient cholesterol levels and soluble plasma sialyltransferase enzyme activity

While soluble forms of the sialyltransferase (sialyl-T) enzyme have been detected in significant quantities in serum, the exact source(s) of the enzyme, or the factors controlling its secretion are poorly understood. In this study, we have examined the relationship between ambient plasma cholesterol concentrations and sialyl-T activities and also levels of constituent plasma sialoglycoproteins (SGP). There was an inverse relationship between levels of the 2,6 sialyl-T enzyme and both total plasma cholesterol and HDL, although no such relationship was observed for the 2,3 enzyme. While there was no correlation between total cholesterol and the levels of plasma SGPs, there was an inverse relationship between the HDL component and 2,3 SGPs.