An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

Impact of Perfusion Map Analysis on Early Survival Prediction Accuracy in Glioma Patients

Studies investigating dynamic susceptibility contrast magnetic resonance imaging-determined relative cerebral blood volume (rCBV) maps as a metric of treatment response assessment have generated conflicting results. We evaluated the potential of various analytical techniques to predict survival of patients with glioma treated with chemoradiation. rCBV maps were acquired in patients with high-grade gliomas at 0, 1, and 3 weeks into chemoradiation therapy. Various analytical techniques were applied to the same cohort of serial rCBV data for early assessment of survival. Three different methodologies were investigated: 1) percentage change of whole tumor statistics (i.e., mean, median, and percentiles), 2) physiological segmentation (low rCBV, medium rCBV, or high rCBV), and 3) a voxel-based approach, parametric response mapping (PRM). All analyses were performed using the same tumor contours, which were determined using contrast-enhanced T1-weighted and fluid attenuated inversion recovery images. The predictive potential of each response metric was assessed at 1-year and overall survival. PRM was the only analytical approach found to generate a response metric significantly predictive of patient 1-year survival. Time of acquisition and contour volume were not found to alter the sensitivity of the PRM approach for predicting overall survival. We have demonstrated the importance of the analytical approach in early response assessment using serial rCBV maps. The PRM analysis shows promise as a unified early and robust imaging biomarker of treatment response in patients diagnosed with high-grade gliomas.     

Arginine kinase isoforms in the closest protozoan relative of metazoans

The genome of the choanoflagellate Monosiga brevicollis contains at least three genes for the phosphoryl transfer enzyme, arginine kinase (AK; EC 2.7.3.3). Bioinformatic analyses of the deduced amino acid sequences of the proteins coded for by two of these genes showed that one of these AKs is cytoplasmic (denoted AK1) while the other appears to have an N-terminal mitochondrial targeting peptide (denoted AK2). Cloning and expression of the cDNA for AK1 yielded considerable soluble AK activity. Three AK2 constructs were expressed - one corresponding to the full length protein and two corresponding to truncated versions in which the signal peptide had been deleted. Expression of the former construct yielded minimal soluble activity. In contrast, significant AK activity was found in both truncated constructs confirming the importance of removal of the targeting peptide for proper folding and catalytic activity. Both AK1 and AK2 are functional oligomers unlike typical AKs which are monomeric. A phylogenetic analysis showed that these choanoflagellate AKs group more closely with a supercluster consisting of cytoplasmic and mitochondrial CKs and invertebrate AKs that evolved secondarily from a CK-like ancestor. Reaction-diffusion constraints in choanoflagellates are likely mitigated by the presence of AK isoforms which facilitate energy transport in these highly polarized cells.     

Early response of the platypus to climate warming

Combining a climatic envelope modelling technique with more than two centuries (1800–2009) of distribution records has revealed the effects of a changing climate on the egg‐laying monotreme, the platypus, Ornithorhynchus anatinus. We show that the main factor associated with platypus occurrence switched from aquatic habitat availability (estimated by rainfall) to thermal tolerances (estimated by annual maximum temperature) in the 1960s. This correlates directly with the change in the annual maximum temperature anomaly from cooler to warmer conditions in southeastern Australia. Modelling of platypus habitat under emission scenarios (A1B, A2, B1 and B2) revealed large decreases (>30%) in thermally suitable habitat by 2070. This reduction, compounded by increasing demands for water for agriculture and potable use, suggests that there is real cause for concern over the future status of this species, and highlights the need for restoration of thermal refugia within the platypus’ modelled range.     

Human lymphokine-activated killer cells: further isolation and characterization of the precursor and effector cell

In a series of experiments we have demonstrated the progressive enrichment (5- to 40-fold) in lymphokine-activated killer (LAK) precursor activity by adherence depletion, sheep red cell rosetting, and depletion of CD3- and DR-positive lymphocytes. The LAK precursor cell thus appears to fall within the 'null' cell population. CD16 and CD11 are cell surface antigens expressed on the surface of the LAK precursor as demonstrated in sorting experiments. A 6- to 100-fold enrichment compared to unseparated peripheral blood was noted when sorted cells positive for CD16 and CD11 were tested. The LAK effector has been identified as being primarily CD3- and CD2+. Similar sorting equipment demonstrated a 7- to 500-fold difference in lytic activity for fresh tumor when comparing CD2+/CD3- and CD2+/CD3+ cells. The CD16+/CD11+ lymphocyte can proliferate in response to interleukin-2 (IL-2) alone in the absence of accessory cells and can be expanded in IL-2 alone with maintenance of lytic activity.     

HCO3- transport in basolateral membrane vesicles isolated from rat renal cortex

The mechanism of HCO3- translocation across the proximal tubule basolateral membrane was investigated by testing for Na+-HCO3- cotransport using isolated membrane vesicles purified from rat renal cortex. As indicated by 22Na+ uptake, imposing an inwardly directed HCO3- concentration gradient induced the transient concentrative accumulation of intravesicular Na+. The stimulation of basolateral membrane vesicle Na+ uptake was specifically HCO3(-)-dependent as only basolateral membrane-independent Na+ uptake was stimulated by an imposed hydroxyl gradient in the absence of HCO3-. No evidence for Na+-HCO3- cotransport was detected in brush border membrane vesicles. Charging the vesicle interior positive stimulated net intravesicular Na+ accumulation in the absence of other driving forces via a HCO3(-)-dependent pathway indicating the flow of negative charge accompanies the Na+-HCO3- cotransport event. Among the anion transport inhibitors tested, 4-4'-diisothiocyanostilbene-2,2'-disulfonic acid demonstrated the strongest inhibitor potency at 1 mM. The Na+-coupled transport inhibitor harmaline also markedly inhibited HCO3- gradient-driven Na+ influx. A role for carbonic anhydrase in the mechanism of Na+-HCO3- cotransport is suggested by the modest inhibition of HCO3- gradient driven Na+ influx caused by acetazolamide. The imposition of Cl- concentration gradients had a marked effect on HCO3- gradient-driven Na+ influx which was furosemide-sensitive and consistent with the operation of a Na+-HCO3- for Cl- exchange mechanism. The results of this study provide evidence for an electrogenic Na+-HCO3- cotransporter in basolateral but not microvillar membrane vesicles isolated from rat kidney cortex. The possible existence of an additional basolateral membrane HCO3(-)-translocating pathway mediating Na+-HCO3- for Cl- exchange is suggested.     

Improving biocontrol of black vine weevil (<Emphasis Type="Italic">Otiorhynchus sulcatus</Emphasis>) with entomopathogenic fungi in growing media by incorporating spent mushroom compost

Amending a peat-based growing medium with 10% v/v spent mushroom compost, a source of fungal chitin and other nutrients, prolonged the persistence of entomopathogenic fungi (Metarhizium brunneum Petsch and Beauveria bassiana (Balsamo) Vuillemin; Hypocreales: Clavicipitaceae). This resulted in improved efficacy of M. brunneum against black vine weevil, Otiorhynchus sulcatus F. (Coleoptera: Curculionidae) larvae compared with using inoculum without spent mushroom compost. B. bassiana only controlled larvae when used in combination with spent mushroom compost (75?±?7% reduction in live larvae). Mixing entomopathogenic fungal inoculum with spent mushroom compost and growing medium was as effective in controlling black vine weevil larvae as using spent mushroom compost colonised with M. brunneum or B. bassiana in the growing medium (80?±?12% reduction in live larvae). The former method is preferable since it does not require production and storage of colonised spent mushroom compost, or registration of new substrate formulations of M. brunneum or B. bassiana.     

Concurrent validity of the Microsoft Kinect for assessment of spatiotemporal gait variables

Spatiotemporal characteristics of gait such as step time and length are often associated with overall physical function in clinical populations, but can be difficult, time consuming and obtrusive to measure. This study assessed the concurrent validity of overground walking spatiotemporal data recorded using a criterion reference – a marker-based three-dimensional motion analysis (3DMA) system – and a low-cost, markerless alternative, the automated skeleton tracking output from the Microsoft Kinect™ (Kinect). Twenty-one healthy adults performed normal walking trials while being monitored using both systems. The outcome measures of gait speed, step length and time, stride length and time and peak foot swing velocity were derived using supervised automated analysis. To assess the agreement between the Kinect and 3DMA devices, Bland–Altman 95% bias and limits of agreement, percentage error, relative agreement (Pearson's correlation coefficients: r) overall agreement (concordance correlation coefficients: r_c) and landmark location linearity as a function of distance from the sensor were determined. Gait speed, step length and stride length from the two devices possessed excellent agreement (r and r_c values >0.90). Foot swing velocity possessed excellent relative (r=0.93) but only modest overall (r_c=0.54) agreement. Step time (r=0.82 and r_c=0.23) and stride time (r=0.69 and r_c=0.14) possessed excellent and modest relative agreement respectively but poor overall agreement. Landmark location linearity was excellent (R²=0.991). This widely available, low-cost and portable system could provide clinicians with significant advantages for assessing some spatiotemporal gait parameters. However, caution must be taken when choosing outcome variables as some commonly reported variables cannot be accurately measured.     

Failure of embryos from bluetongue infected cattle to transmit virus to susceptible recipients or their offspring

Sixty heifers were infected with bluetongue virus (BTV) by the bites of the vector and by inoculation with insect origin virus. During the acute and convalescent stages of the infection, embryos were collected nonsurgically from these animals and washed according to the recommendations of the International Embryo Transfer Society (1). No BTV was isolated from 77 of these embryos when they were inoculated onto cell culture and into embryonating chicken eggs. There was no evidence of lateral BTV transmission when 231 of these embryos were transferred into susceptible recipients, nor was there evidence of vertical BTV transmission to the 88 calves resulting from these transfers. Another six donors that were assumed to have recovered from a natural infection of BTV, were added to the study to increase the probability of obtaining embryos from a persistently infected BTV carrier. However, it was determined later that these animals had not been infected with BTV but with the closely-related epizootic hemorrhagic disease virus (EHDV). Embryos were collected from these donors and washed as above. Neither BTV nor EHDV was isolated from 26 of these embryos by the inoculation of cell culture and embryonating chicken eggs. There was no evidence of lateral BTV or EHDV transmission to recipients of 15 of these embryos or of vertical BTV or EHDV transmission to the resulting 7 calves. However, two recipients of embryos from one of these donors developed antibodies to BTV 6 to 9 months after transfer. Passive antibodies to BTV were also detected in their calves. There is good evidence that these two recipients acquired BTV from natural exposure to infected insect vectors and not from the transferred embryos.     

Learning curves, taking instructions, and patient safety: using a theoretical domains framework in an interview study to investigate prescribing errors among trainee doctors

ABSTRACT: BACKGROUND: Prescribing errors are a major source of morbidity and mortality and represent a significant patient safety concern. Evidence suggests that trainee doctors are responsible for most prescribing errors. Understanding the factors that influence prescribing behavior may lead to effective interventions to reduce errors. Existing investigations of prescribing errors have been based on Human Error Theory but not on other relevant behavioral theories. The aim of this study was to apply a broad theory-based approach using the Theoretical Domains Framework (TDF) to investigate prescribing in the hospital context among a sample of trainee doctors. METHOD: Semistructured interviews, based on 12 theoretical domains, were conducted with 22 trainee doctors to explore views, opinions, and experiences of prescribing and prescribing errors. Content analysis was conducted, followed by applying relevance criteria and a novel stage of critical appraisal, to identify which theoretical domains could be targeted in interventions to improve prescribing. RESULTS: Seven theoretical domains met the criteria of relevance: "social professional role and identity," "environmental context and resources," "social influences," "knowledge," "skills," "memory, attention, and decision making," and "behavioral regulation." From critical appraisal of the interview data, "beliefs about consequences" and "beliefs about capabilities" were also identified as potentially important domains. Interrelationships between domains were evident. Additionally, the data supported theoretical elaboration of the domain behavioral regulation. CONCLUSIONS: In this investigation of hospital-based prescribing, participants' attributions about causes of errors were used to identify domains that could be targeted in interventions to improve prescribing. In a departure from previous TDF practice, critical appraisal was used to identify additional domains that should also be targeted, despite participants' perceptions that they were not relevant to prescribing errors. These were beliefs about consequences and beliefs about capabilities. Specifically, in the light of the documented high error rate, beliefs that prescribing errors were not likely to have consequences for patients and that trainee doctors are capable of prescribing without error should also be targeted in an intervention. This study is the first to suggest critical appraisal for domain identification and to use interview data to propose theoretical elaborations and interrelationships between domains.