Phloroglucinol in plant tissue culture

In plant tissue culture research, there is a constant need to search for novel substances that could result in better or more efficient growth in vitro. A relatively unknown compound, phloroglucinol (1,3,5-trihydroxybenzene), which is a degradation product of phloridzin, has growth-promoting properties. Phloroglucinol increases shoot formation and somatic embryogenesis in several horticultural and grain crops. When added to rooting media together with auxin, phloroglucinol further stimulates rooting, most likely because phloroglucinol and its homologues act as auxin synergists or auxin protectors. Of particular interest is the ability of phloroglucinol—a precursor in the lignin biosynthesis pathway—to effectively control hyperhydricity through the process of lignification, thus maximizing the multiplication rate of woody species and other species that are difficult to propagate. Phloroglucinol has also been used to improve the recovery of cryopreserved Dendrobium protocorms, increasing the potential of cryopreservation for application in ornamental biotechnology. Phloroglucinol demonstrates both cytokinin-like and auxin-like activity, much like thidiazuron, and thus has considerable potential for application in a wide range of plant tissue culture studies.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

Genetic Background Can Result in a Marked or Minimal Effect of Gene Knockout (GPR55 and CB2 Receptor) in Experimental Autoimmune Encephalomyelitis Models of Multiple Sclerosis

Endocannabinoids and some phytocannabinoids bind to CB₁ and CB₂ cannabinoid receptors, transient receptor potential vanilloid one (TRPV1) receptor and the orphan G protein receptor fifty-five (GPR55). Studies using C57BL/10 and C57BL/6 (Cnr2 ^tm1Zim) CB₂ cannabinoid receptor knockout mice have demonstrated an immune-augmenting effect in experimental autoimmune encephalomyelitis (EAE) models of multiple sclerosis. However, other EAE studies in Biozzi ABH mice often failed to show any treatment effect of either CB₂ receptor agonism or antagonism on inhibition of T cell autoimmunity. The influence of genetic background on the induction of EAE in endocannabinoid system-related gene knockout mice was examined. It was found that C57BL/6.GPR55 knockout mice developed less severe disease, notably in female mice, following active induction with myelin oligodendrocyte glycoprotein 35-55 peptide. In contrast C57BL/6.CB₂ (Cnr2 ^Dgen) receptor knockout mice developed augmented severity of disease consistent with the genetically and pharmacologically-distinct, Cnr2 ^tm1Zim mice. However, when the knockout gene was bred into the ABH mouse background and EAE induced with spinal cord autoantigens the immune-enhancing effect of CB₂ receptor deletion was lost. Likewise CB₁ receptor and transient receptor potential vanilloid one knockout mice on the ABH background demonstrated no alteration in immune-susceptibility, in terms of disease incidence and severity of EAE, in contrast to that reported in some C57BL/6 mouse studies. Furthermore the immune-modulating influence of GPR55 was marginal on the ABH mouse background. Whilst sedative doses of tetrahydrocannabinol could induce immunosuppression, this was associated with a CB₁ receptor rather than a CB₂ receptor-mediated effect. These data support the fact that non-psychoactive doses of medicinal cannabis have a marginal influence on the immune response in MS. Importantly, it adds a note of caution for the translational value of some transgenic/gene knockout and other studies on low-EAE susceptibility backgrounds with inconsistent disease course and susceptibility.     

Identification of Pyrus Single Nucleotide Polymorphisms (SNPs) and Evaluation for Genetic Mapping in European Pear and Interspecific Pyrus Hybrids

We have used new generation sequencing (NGS) technologies to identify single nucleotide polymorphism (SNP) markers from three European pear (Pyrus communis L.) cultivars and subsequently developed a subset of 1096 pear SNPs into high throughput markers by combining them with the set of 7692 apple SNPs on the IRSC apple Infinium® II 8K array. We then evaluated this apple and pear Infinium® II 9K SNP array for large-scale genotyping in pear across several species, using both pear and apple SNPs. The segregating populations employed for array validation included a segregating population of European pear (‘Old Home’בLouise Bon Jersey’) and four interspecific breeding families derived from Asian (P. pyrifolia Nakai and P. bretschneideri Rehd.) and European pear pedigrees. In total, we mapped 857 polymorphic pear markers to construct the first SNP-based genetic maps for pear, comprising 78% of the total pear SNPs included in the array. In addition, 1031 SNP markers derived from apple (13% of the total apple SNPs included in the array) were polymorphic and were mapped in one or more of the pear populations. These results are the first to demonstrate SNP transferability across the genera Malus and Pyrus. Our construction of high density SNP-based and gene-based genetic maps in pear represents an important step towards the identification of chromosomal regions associated with a range of horticultural characters, such as pest and disease resistance, orchard yield and fruit quality.     

Phenotypic Plasticity of Southern Ocean Diatoms: Key to Success in the Sea Ice Habitat?

Diatoms are the primary source of nutrition and energy for the Southern Ocean ecosystem. Microalgae, including diatoms, synthesise biological macromolecules such as lipids, proteins and carbohydrates for growth, reproduction and acclimation to prevailing environmental conditions. Here we show that three key species of Southern Ocean diatom (Fragilariopsis cylindrus, Chaetoceros simplex and Pseudo-nitzschia subcurvata) exhibited phenotypic plasticity in response to salinity and temperature regimes experienced during the seasonal formation and decay of sea ice. The degree of phenotypic plasticity, in terms of changes in macromolecular composition, was highly species-specific and consistent with each species’ known distribution and abundance throughout sea ice, meltwater and pelagic habitats, suggesting that phenotypic plasticity may have been selected for by the extreme variability of the polar marine environment. We argue that changes in diatom macromolecular composition and shifts in species dominance in response to a changing climate have the potential to alter nutrient and energy fluxes throughout the Southern Ocean ecosystem.     

Non-Essential Role for TLR2 and Its Signaling Adaptor Mal/TIRAP in Preserving Normal Lung Architecture in Mice

Myeloid differentiation factor 88 (MyD88) and MyD88-adaptor like (Mal)/Toll-interleukin 1 receptor domain containing adaptor protein (TIRAP) play a critical role in transducing signals downstream of the Toll-like receptor (TLR) family. While genetic ablation of the TLR4/MyD88 signaling axis in mice leads to pulmonary cell death and oxidative stress culminating in emphysema, the involvement of Mal, as well as TLR2 which like TLR4 also signals via MyD88 and Mal, in the pathogenesis of emphysema has not been studied. By employing an in vivo genetic approach, we reveal here that unlike the spontaneous pulmonary emphysema which developed in Tlr4^−/− mice by 6 months of age, the lungs of Tlr2^−/− mice showed no physiological or morphological signs of emphysema. A more detailed comparative analysis of the lungs from these mice confirmed that elevated oxidative protein carbonylation levels and increased numbers of alveolar cell apoptosis were only detected in Tlr4^−/− mice, along with up-regulation of NADPH oxidase 3 (Nox3) mRNA expression. With respect to Mal, the architecture of the lungs of Mal^−/− mice was normal. However, despite normal oxidative protein carbonylation levels in the lungs of emphysema-free Mal^−/− mice, these mice displayed increased levels of apoptosis comparable to those observed in emphysematous Tlr4^−/− mice. In conclusion, our data provide in vivo evidence for the non-essential role for TLR2, unlike the related TLR4, in maintaining the normal architecture of the lung. In addition, we reveal that Mal differentially facilitates the anti-apoptotic, but not oxidant suppressive, activities of TLR4 in the lung, both of which appear to be essential for TLR4 to prevent the onset of emphysema.     

Elevation,Temperature, and Aquatic Connectivity All Influence the Infection Dynamics of the Amphibian Chytrid Fungus in Adult Frogs

Infectious diseases can cause population declines and even extinctions. The amphibian chytrid fungus, Batrachochytrium dendrobatidis (Bd), has caused population declines and extinctions in amphibians on most continents. In the tropics, research on the dynamics of this disease has focused on amphibian populations in mountainous areas. In most of these areas, high and low elevation sites are connected by an assemblage of streams that may transport the infectious stage of the pathogen from high to low elevations, and, also, this pathogen, which grows well at cool temperatures, may persist better in cooler water flowing from high elevations. Thus, the dynamics of disease at low elevation sites without aquatic connections to higher elevation sites, i.e., non-contiguous low elevation sites, may differ from dynamics at contiguous low elevation sites. We sampled adult common mistfrogs (Litoria rheocola) at six sites of three types: two at high (> 400m) elevations, two at low elevations contiguous with high elevation streams, and two at low elevations non-contiguous with any high elevation site. Adults were swabbed for Bd diagnosis from June 2010 to June 2011 in each season, over a total of five sampling periods. The prevalence of Bd fluctuated seasonally and was highest in winter across all site types. Site type significantly affected seasonal patterns of prevalence of Bd. Prevalence remained well above zero throughout the year at the high elevation sites. Prevalence declined to lower levels in contiguous low sites, and reached near-zero at non-contiguous low sites. Patterns of air temperature fluctuation were very similar at both the low elevation site types, suggesting that differences in water connectivity to high sites may have affected the seasonal dynamics of Bd prevalence between contiguous and non-contiguous low elevation site types. Our results also suggest that reservoir hosts may be important in the persistence of disease at low elevations.