Bacopasaponins with cytotoxic activity against human breast cancer cells in vitro

Molecular Biology Reports - Globally, breast cancer is a serious concern that exhibits a persistent rise in its incidence and related mortality even after significant advancement in the field of...     

La Vegetazione e L'ecologia Di Pratofiorito (Appennino Settentrionale)

Abstract

Ecology and vegetazion of mount Pratofiorito. — The author examines position, climatic conditions, geological nature and vegetation of Mount « Pratofiorito » in the Tuscan Appennine.

Mount Pratofiorito is a residue of secondary rocks and derived soil surrounded by tertiary and quaternary rocks and soil.

Its vegetations is actually constituted by grass-land and so it differs-from that of the neihbouring mountains which comprises the flora has been made. This list was then comparend with spades found in the adjacent beech and helm-oak zones.

From these comparisons one can deduce thath the meadow of « Graminaceae » and « Cyperaceae » growing on Mount Pratofiorito may bed considered as a grass-land resulting from the degradation of an arboreal zone, problably from a beech-wood.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

Smokeless Tobacco Extract (STE)-Induced Toxicity in Mammalian Cells is Mediated by the Disruption of Cellular Microtubule Network: A Key Mechanism of Cytotoxicity

Smokeless tobacco usage is a growing public health problem worldwide. The molecular mechanism(s) underlying smokeless tobacco associated tissue damage remain largely unidentified. In the present study we have tried to explore the effects of aqueous extract of smokeless tobacco (STE) on tubulin-microtubule, the major cytoskeleton protein that maintains cells morphology and participates in cell division. Exposure to STE resulted in dose-dependent cytotoxicity in a variety of mammalian transformed cell lines such as human lung epithelial cells A549, human liver epithelial cells HepG2, and mouse squamous epithelial cells HCC7, as well as non-tumorogenic human peripheral blood mononuclear cells PBMC. Cellular morphology of STE-treated cells was altered and the associated disruption of microtubule network indicates that STE targets tubulin-microtubule system in both cell lines. Furthermore it was also observed that STE-treatment resulted in the selective degradation of cellular tubulin, whereas actin remains unaltered. In vitro, polymerization of purified tubulin was inhibited by STE with the IC₅₀ value∼150 µg/ml and this is associated with the loss of reactive cysteine residues of tubulin. Application of thiol-based antioxidant N-acetyl cysteine (NAC) significantly abrogates STE-mediated microtubule damage and associated cytotoxicity in both A549 and HepG2 cells. These results suggest that microtubule damage is one of the key mechanisms of STE-induced cytotoxity in mammalian cells.     

miRNA Biogenesis Enzyme Drosha Is Required for Vascular Smooth Muscle Cell Survival

miRNA biogenesis enzyme Drosha cleaves double-stranded primary miRNA by interacting with double-stranded RNA binding protein DGCR8 and processes primary miRNA into precursor miRNA to participate in the miRNA biogenesis pathway. The role of Drosha in vascular smooth muscle cells (VSMCs) has not been well addressed. We generated Drosha conditional knockout (cKO) mice by crossing VSMC-specific Cre mice, SM22-Cre, with Drosha ^loxp/loxp mice. Disruption of Drosha in VSMCs resulted in embryonic lethality at E14.5 with severe liver hemorrhage in mutant embryos. No obvious developmental delay was observed in Drosha cKO embryos. The vascular structure was absent in the yolk sac of Drosha homozygotes at E14.5. Loss of Drosha reduced VSMC proliferation in vitro and in vivo. The VSMC differentiation marker genes, including αSMA, SM22, and CNN1, and endothelial cell marker CD31 were significantly downregulated in Drosha cKO mice compared to controls. ERK1/2 mitogen-activated protein kinase and the phosphatidylinositol 3-kinase/AKT were attenuated in VSMCs in vitro and in vivo. Disruption of Drosha in VSMCs of mice leads to the dysregulation of miRNA expression. Using bioinformatics approach, the interactions between dysregulated miRNAs and their target genes were analyzed. Our data demonstrated that Drosha is required for VSMC survival by targeting multiple signaling pathways.     

Differential Response of Chondrocytes and Chondrogenic-Induced Mesenchymal Stem Cells to C1-OH Tributanoylated N-Acetylhexosamines

Articular cartilage has a limited ability to self-repair because of its avascular nature and the low mitotic activity of the residing chondrocytes. There remains a significant need to develop therapeutic strategies to increase the regenerative capacity of cells that could repair cartilage. Multiple cell types, including chondrocytes and mesenchymal stem cells, have roles in articular cartilage regeneration. In this study, we evaluated a platform technology of multiple functionalized hexosamines, namely 3,4,6-O-tributanoylated-N-acetylgalactosamine (3,4,6-O-Bu₃GalNAc), 3,4,6-O-tributanoylated-N-acetylmannosamine (3,4,6-O-Bu₃ManNAc) and 3,4,6-O-Bu₃GlcNAc, with the potential ability to reduce NFκB activity. Exposure of IL-1β-stimulated chondrocytes to the hexosamine analogs resulted in increased expression of ECM molecules and a corresponding improvement in cartilage-specific ECM accumulation. The greatest ECM accumulation was observed with 3,4,6-O-Bu₃GalNAc. In contrast, mesenchymal stem cells (MSCs) exposed to 3,4,6-O-Bu₃GalNAc exhibited a dose dependent decrease in chondrogenic differentation as indicated by decreased ECM accumulation. These studies established the disease modification potential of a hexosamine analog platform on IL-1β-stimulated chondrocytes. We determined that the modified hexosamine with the greatest potential for disease modification is 3,4,6-O-Bu₃GalNAc. This effect was distinctly different with 3,4,6-O-Bu₃GalNAc exposure to chondrogenic-induced MSCs, where a decrease in ECM accumulation and differentiation was observed. Furthermore, these studies suggest that NFκB pathway plays a complex role cartilage repair.     

Evidence That Inconsistent Gene Prediction Can Mislead Analysis of Dinoflagellate Genomes

Comparative algal genomics often relies on predicted genes from de novo assembled genomes. However, the artifacts introduced by different gene-prediction approaches, and their impact on comparative genomic analysis remain poorly understood. Here, using available genome data from six dinoflagellate species in the Symbiodiniaceae, we identified methodological biases in the published genes that were predicted using different approaches and putative contaminant sequences in the published genome assemblies. We developed and applied a comprehensive customized workflow to predict genes from these genomes. The observed variation among predicted genes resulting from our workflow agreed with current understanding of phylogenetic relationships among these taxa, whereas the variation among the previously published genes was largely biased by the distinct approaches used in each instance. Importantly, these biases affect the inference of homologous gene families and synteny among genomes, thus impacting biological interpretation of these data. Our results demonstrate that a consistent gene-prediction approach is critical for comparative analysis of dinoflagellate genomes.     

Bayesian data integration and variable selection for pan-cancer survival prediction using protein expression data

Accurate prognostic prediction using molecular information is a challenging area of research, which is essential to develop precision medicine. In this paper, we develop translational models to identify major actionable proteins that are associated with clinical outcomes, like the survival time of patients. There are considerable statistical and computational challenges due to the large dimension of the problems. Furthermore, data are available for different tumor types; hence data integration for various tumors is desirable. Having censored survival outcomes escalates one more level of complexity in the inferential procedure. We develop Bayesian hierarchical survival models, which accommodate all the challenges mentioned here. We use the hierarchical Bayesian accelerated failure time model for survival regression. Furthermore, we assume sparse horseshoe prior distribution for the regression coefficients to identify the major proteomic drivers. We borrow strength across tumor groups by introducing a correlation structure among the prior distributions. The proposed methods have been used to analyze data from the recently curated “The Cancer Proteome Atlas” (TCPA), which contains reverse-phase protein arrays–based high-quality protein expression data as well as detailed clinical annotation, including survival times. Our simulation and the TCPA data analysis illustrate the efficacy of the proposed integrative model, which links different tumors with the correlated prior structures.