The RNA Domain Vc1 Regulates Downstream Gene Expression in Response to Cyclic Diguanylate in Vibrio cholerae

In many bacterial species, including the aquatic bacterium and human pathogen Vibrio cholerae, the second messenger cyclic diguanylate (c-di-GMP) modulates processes such as biofilm formation, motility, and virulence factor production. By interacting with various effectors, c-di-GMP regulates gene expression or protein function. One type of c-di-GMP receptor is the class I riboswitch, representatives of which have been shown to bind c-di-GMP in vitro. Herein, we examined the in vitro and in vivo function of the putative class I riboswitch in Vibrio cholerae, Vc1, which lies upstream of the gene encoding GbpA, a colonization factor that contributes to attachment of V. cholerae to environmental and host surfaces containing N-acetylglucosamine moieties. We provide evidence that Vc1 RNA interacts directly with c-di-GMP in vitro, and that nucleotides conserved among this class of riboswitch are important for binding. Yet the mutation of these conserved residues individually in the V. cholerae chromosome inconsistently affects the expression of gbpA and production of the GbpA protein. By isolating the regulatory function of Vc1, we show that the Vc1 element positively regulates downstream gene expression in response to c-di-GMP. Together these data suggest that the Vc1 element responds to c-di-GMP in vivo. Positive regulation of gbpA expression by c-di-GMP via Vc1 may influence the ability of V. cholerae to associate with chitin in the aquatic environment and the host intestinal environment.     

Flow cytometric determination of cell proliferation in hypertensive blood vessels.

BACKGROUND: Measurement of vascular cell proliferation in animal models of hypertension is currently accomplished by demonstrating [(3)H]-thymidine ([(3)H]-dT) incorporation into DNA using autoradiography. This method, however, is labor intensive, requires radioactivity, and is limited by the inherent difficulty in discriminating labeled and unlabeled cells. To address these limitations, a flow cytometric-based method is described utilizing incorporation of 5-bromo-2'-deoxyuridine (BrdU) into DNA of nuclei isolated from blood vessels. METHODS: Pulmonary hypertension was induced in rats by exposure to 10% O(2) (hypoxia) for varying periods of time. Pulmonary arteries and aorta from rats injected with BrdU prior to sacrifice were isolated, fixed with 10% formalin, and digested with Protease XIV. The intact nuclei liberated by this treatment were successively treated with HCl/Triton X-100 and sodium borate. Processed nuclei were probed with a BrdU-specific fluorescein-conjugated antibody, and the percentage of BrdU staining cells was determined using flow cytometry. RESULTS: An approximately 20-fold increase in BrdU-positive cells at 3 days of hypoxia in pulmonary arteries (relative to control) with no change in aorta was observed. These results were similar to previous studies using [(3)H]-dT labeling. CONCLUSIONS: Flow cytometric determination of cell proliferation in blood vessels is a simple, objective technique that may facilitate measurement of cell proliferation in animal models of vascular disease.     

Arabidopsis thaliana nucleosidase mutants provide new insights into nucleoside degradation

A central step in nucleoside and nucleobase salvage pathways is the hydrolysis of nucleosides to their respective nucleobases. In plants this is solely accomplished by nucleosidases (EC 3.2.2.x). To elucidate the importance of nucleosidases for nucleoside degradation, general metabolism, and plant growth, thorough phenotypic and biochemical analyses were performed using Arabidopsis thaliana T-DNA insertion mutants lacking expression of the previously identified genes annotated as uridine ribohydrolases (URH1 and URH2). Comprehensive functional analyses of single and double mutants demonstrated that both isoforms are unimportant for seedling establishment and plant growth, while one participates in uridine degradation. Rather unexpectedly, nucleoside and nucleotide profiling and nucleosidase activity screening of soluble crude extracts revealed a deficiency of xanthosine and inosine hydrolysis in the single mutants, with substantial accumulation of xanthosine in one of them. Mixing of the two mutant extracts, and by in vitro activity reconstitution using a mixture of recombinant URH1 and URH2 proteins, both restored activity, thus providing biochemical evidence that at least these two isoforms are needed for inosine and xanthosine hydrolysis. This mutant study demonstrates the utility of in vivo systems for the examination of metabolic activities, with the discovery of the new substrate xanthosine and elucidation of a mechanism for expanding the nucleosidase substrate spectrum.     

Mechanistic logic underlying the axonal transport of cytosolic proteins

Proteins vital to presynaptic function are synthesized in the neuronal perikarya and delivered into synapses via two modes of axonal transport. While membrane-anchoring proteins are conveyed in fast axonal transport via motor-driven vesicles, cytosolic proteins travel in slow axonal transport via mechanisms that are poorly understood. We found that in cultured axons, populations of cytosolic proteins tagged to photoactivatable GFP (PAGFP) move with a slow motor-dependent anterograde bias distinct from both vesicular trafficking and diffusion of untagged PAGFP. The overall bias is likely generated by an intricate particle kinetics involving transient assembly and short-range vectorial spurts. In vivo biochemical studies reveal that cytosolic proteins are organized into higher order structures within axon-enriched fractions that are largely segregated from vesicles. Data-driven biophysical modeling best predicts a scenario where soluble molecules dynamically assemble into mobile supramolecular structures. We propose a model where cytosolic proteins are transported by dynamically assembling into multiprotein complexes that are directly/indirectly conveyed by motors.     

Novel retinoic acid receptor alpha agonists for treatment of kidney disease

Development of pharmacologic agents that protect podocytes from injury is a critical strategy for the treatment of kidney glomerular diseases. Retinoic acid reduces proteinuria and glomerulosclerosis in multiple animal models of kidney diseases. However, clinical studies are limited because of significant side effects of retinoic acid. Animal studies suggest that all trans retinoic acid (ATRA) attenuates proteinuria by protecting podocytes from injury. The physiological actions of ATRA are mediated by binding to all three isoforms of the nuclear retinoic acid receptors (RARs): RARα, RARβ, and RARγ. We have previously shown that ATRA exerts its renal protective effects mainly through the agonism of RARα. Here, we designed and synthesized a novel boron-containing derivative of the RARα-specific agonist Am580. This new derivative, BD4, binds to RARα receptor specifically and is predicted to have less toxicity based on its structure. We confirmed experimentally that BD4 binds to RARα with a higher affinity and exhibits less cellular toxicity than Am580 and ATRA. BD4 induces the expression of podocyte differentiation markers (synaptopodin, nephrin, and WT-1) in cultured podocytes. Finally, we confirmed that BD4 reduces proteinuria and improves kidney injury in HIV-1 transgenic mice, a model for HIV-associated nephropathy (HIVAN). Mice treated with BD4 did not develop any obvious toxicity or side effect. Our data suggest that BD4 is a novel RARα agonist, which could be used as a potential therapy for patients with kidney disease such as HIVAN.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Pathogenetic mechanisms in hereditary dysfunctions of complex I of the respiratory chain in neurological diseases

This paper covers genetic and biochemical aspects of mitochondrial bioenergetics dysfunction in hereditary neurological disorders associated with complex I defects. Three types of hereditary complex I dysfunction are dealt with: (i) homozygous mutations in the nuclear genes NDUFS1 and NDUFS4 of complex I, associated with mitochondrial encephalopathy; (ii) a recessive hereditary epileptic neurological disorder associated with enhanced proteolytic degradation of complex I; (iii) homoplasmic mutations in the ND5 and ND6 mitochondrial genes of the complex, cohexistent with mutation in the nuclear PINK1 gene in familial Parkinsonism. The genetic and biochemical data examined highlight different mechanisms by which mitochondrial bioenergetics is altered in these hereditary defects of complex I. This knowledge, besides clarifying molecular aspects of the pathogenesis of hereditary diseases, can also provide hints for understanding the involvement of complex I in sporadic neurological disorders and aging, as well as for developing therapeutical strategies.     

Tuning the conformational properties of the prion peptide

Previously, we disclosed that O‐linked glycosylation of Ser‐132 or Ser‐135 could dramatically change the amyloidogenic property of the hamster prion peptide (sequence 108–144). This peptide, which corresponds to the flexible loop and the first β‐strand in the structure of the prion protein, is a random coil when it is initially dissolved in buffer, but amyloid fibrils are formed with time. Thus, it offers a convenient model system to observe and compare how different chemical modifications and sequence mutations alter the amyloidogenic property of the peptide within a reasonable experimental time frame. In our earlier study, aside from uncovering a site‐specificity of the glycosylation on the fibrillogenesis, different effects of α‐GalNAc and β‐GlcNAc were observed. In this work, we explore further how different sugar configurations affect the conformational property of the polypeptide chain. We compare the effects of O‐linked glycosylation by the common sugars α‐GalNAc, β‐GlcNAc with their non‐native analogs β‐GalNAc, α‐GlcNAc in an effort to uncover the origin of the sugar‐specificity on the fibril formation. We find that the anomeric configuration of the sugar is the most important factor affecting the fibrillogenesis. Sugars with the glycosidic bond in the α‐configuration at Ser‐135 have a dramatic inhibitory effect on the structural conversion of the glycosylated peptide. Because O‐glycosylation of Ser‐135 with α‐linked sugars also promote the formation of three slowly converting conformations at the site of glycosylation, we surmise that the amyloidogenic property of the peptide is related to its conformational flexibility, and the proclivity of this region of the peptide to undergo the structural conversion from the random coil to form the β‐structure. Upon O‐glycosylation with an α‐linked sugar, this conversion is inhibited and the nucleation of fibril formation is largely retarded. Consistent with this scenario, Arg‐136 is the residue most affected in the TOCSY NMR spectra of the glycosylated peptides, other than the serine site modified. In addition, when Arg‐136 is substituted by Gly, a mutation that should provide higher structural flexibility in this part of the peptide, the amyloidogenic property of the peptide is greatly enhanced, and the inhibition effect of glycosylation is largely diminished. These results are consistent with Ser‐135 and Arg‐136 being part of the kink region involved in the structural conversion. Proteins 2009. © 2008 Wiley‐Liss, Inc.     

Constitutive mutations of Agrobacterium tumefaciens transcriptional activator virG.

The virulence (vir) genes of Agrobacterium tumefaciens Ti plasmids are positively regulated by virG in conjunction with virA and plant-derived inducing molecules. A procedure that utilizes both genetic selection and a genetic screen was developed to isolate mutations in virG that led to elevated levels of vir gene expression in the absence of virA and plant phenolic inducers. Mutants were isolated at a frequency of 1 in 10(7) to 10(8). Substitution mutations at two positions in the virG coding region were found to result in the desired phenotype. One mutant had an asparagine-to-aspartic acid substitution at residue 54, and the other contained an isoleucine-to-leucine substitution at residue 106. In both cases, the mutant phenotype required the presence of the active-site aspartic acid residue at position 52. Further analysis showed that no other substitution at residue 54 resulted in a constitutive phenotype. In contrast, several substitutions at residue 106 led to a constitutive phenotype. The possible roles of the residues at positions 54 and 106 in VirG function are discussed.