The preservation of Mycoplasma capricolum cell intactness after phospholipase A2 treatment

(1) By treating Mycoplasma capricolum cells with phospholipase A₂ about 80% of membrane phospholipids were rapidly hydrolyzed. The rate and extent of hydrolysis (at 37°C) were the same in intact cells and in isolated unsealed membranes. (2) Due to the low endogenous lysophospholipase activity detected in M. capricolum, phospholipase A₂ treatment resulted in the accumulation of lysophospholipids and free fatty acids. The free fatty acids were efficiently extracted from the cells by 1% bovine serum albumin whereas the lysophospholipids were almost fully retained within the cell membrane. (3) Following phospholipase A₂ treatment in the presence of 1% bovine serum albumin, cell intactness was preserved as indicated by the constant absorbance of the cell suspension and the retention of nucleic acids and NADH dehydrogenase activity within the cells. The treated cells showed, however, a slight decrease in K⁺ content and a decrease in cell viability. Viability was fully preserved after phospholipase A₂ treatment of cells grown with exogenous sphingomyelin. (4) Adapting M. capricolum to a cholesterol-poor medium resulted in a marked decrease in the cholesterol to phospholipid molar ratio (from about 1.1 to 0.3). Phospholipase A₂ treatment of the cholesterol-poor cells resuted in cell lysis. Cell lysis was induced in the cholesterol-rich cells by hydrolysing the lysophospholipids accumulated following phospholipase A₂ treatment. (5) It is suggested that after phospholipase A₂ treatment of M. capricolum cells, a relatively stable cell membrane is maintained and cell intactness is preseved due to the interaction of cholesterol, present in high amount in this membrane, with the lysophospholipids formed.     

Multiple ribosome binding to the 5'-terminal leader sequence of tobacco mosaic virus RNA. Assembly of an 80S ribosome X mRNA complex at the AUU codon

Tobacco mosaic virus (TMV) RNA with a long 5'-terminal leader sequence, as well as its isolated leader fragment (called omega), can form disome initiation complexes with wheat germ ribosomes. The second ribosome of the disome complex is bound to the leader sequence, upstream of an 80S particle occupying the AUG-containing initiation site [ Filipowicz and Haenni (1979) Proc. Natl Acad. Sci. USA 76, 3111-3115; Konarska et al. (1981) Eur. J. Biochem. 114, 221-227]. In order to identify the parts of omega important for interaction with ribosomes, the 5'-terminally-labelled omega was treated with alkali and the resultant fragments of different lengths were used in binding experiments. A 16-nucleotide-long fragment bearing the AUU sequence at the 3' end is the shortest oligonucleotide capable of forming 80S complexes with wheat germ ribosomes. Full-length (73 nucleotides) omega with AUG at the 3' terminus is the only RNA fragment supporting disome complex formation. Synthetic oligoribonucleotides were prepared for a study of 80S complex assembly at codons other than AUG. Hexadecanucleotide (A) 13A -U-U and, to lesser extent, also (A) 13A -U-C, (A) 13A -U-A and (A) 13A -C-G bind 80S ribosomes. Formation of the (A) 13A -U-U X 80S complex is dependent on the presence of initiator Met- tRNAMerf . Assembly of the 80S particle at the AUU sequence is not an artifact resulting from the terminal position of this triplet. (A) 13A -U-U elongated with over 100 A residues still efficiently binds an 80S ribosome positioned, as established by ribosome protection experiments, at the AUU triplet. The present results support the notion that 80S initiation-like complexes can be formed at sequences containing AUU codons. The possible function of these complexes as intermediates in initiation of translation of some viral RNAs is discussed.     

Gradient thin-layer chromatography of oligonucleotides on DEAE-cellulose: an alternative to homochromatography.

Homochromatography fingerprints are widely used for sequence studies of labeled RNA: however, the more general use of this method is restricted in several aspects by the large excess of RNA introduced by the homomix. Gradient thin-layer chromatography on DEAE-cellulose plates using ammonium formate gradients in 9 m urea provides an efficient procedure for preparing fingerprints of labeled as well as unlabeled RNA, and allows the isolation of oligonucleotides free of salt, urea, and carrier RNA. This method produces fingerprints similar to those obtained by homochromatography under appropriate conditions. Consequently, gradient thin-layer chromatography is a convenient alternative to homochromatography without some of its limitations.     

Increase in drug resistance among Shigella dysenteriae,Sh flexneri,and Sh boydii.

Two thousand three hundred and seventy strains of Shigella dysenteriae, Sh flexneri, and Sh boydii isolated in England and Wales from 1974 to 1978 were tested for resistance to 12 antimicrobial drugs. Eighty per cent of strains were resistant to one or more drugs, with sulphonamide resistance occurring most frequently. Resistance to streptomycin, tetracycline, ampicillin, and chloramphenicol increased during the period, as did the incidence of multiple resistance. Most infections due to Sh dysenteriae, Sh flexneri, and Sh boydii are acquired abroad, and the increasing incidence of drug resistance among these organisms contrasts with the decreasing incidence of resistance among the indigenous Sh sonnei. These findings may indicate the need for better control of antibiotic use, particularly in developing countries.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Medical and surgical approach to laryngeal air sacculitis in a baboon caused by Pasteurella multocida.

Air sacculitis was diagnosed in a chronically chaired baboon, Papio anubis. Pasteurella multocida was repeatedly isolated from the air sac for a period of 1 year. The condition was characterized by the continuous accumulation of either mucoserous or purulent fluid. Biopsies of the air sac taken during the course of the disease initially revealed goblet cell hyperplasia. Later a subepithalial mononuclear or polymorphonuclear infiltrate and necrosis was the predominate finding. Medical therapy was only intermittently successful and consisted of frequent drainage and antibiotics administered locally and intravenously. The condition was resolved after surgical resection of the air sac lining membrane.     

Studies on dehydro-l-ascorbic acid 2-arylhydrazone 3-oximes: Conversion into substituted triazoles and isoxazolines

l-threo-2,3-Hexodiulosono-1,4-lactone 2-(arylhydrazones) (2) were prepared by condensation of dehydro-l-ascorbic acid with various arylhydrazines. Reaction of 2 with hydroxylamine gave the 2-(arylhydrazone) 3-oximes (3). On boiling with acetic anhydride, 3 gave 2-aryl-4-(2,3-di-O-acetyl-l-threo-glycerol-l-yl)-1,2,3-triazole-5-carboxylic acid 5,4¹-lactones (4). On treatment of 4 with liquid ammonia, 2-aryl-4-(l-threo-glycerol-l-yl)-1,2,3-triazole-5-carboxamides (5) were obtained. Acetylation of 5 with acetic anhydride-pyridine gave the triacetates, and vigorous acetylation with boiling acetic anhydride gave the tetraacetyl derivatives. Periodate oxidation of 5 gave the 2-aryl-4-formyl-1,2,3-triazole-5-carboxamides (8), and, on reduction, 8 gave the 2-aryl-4-(hydroxymethyl)-1,2,3-triazole-5-carboxamides, characterized as the monoacetates and diacetates. Controlled reaction of 2 with sodium hydroxide, followed by neutralization, gave 3-(l-threo-glycerol-l-yl)-4,5-isoxazolinedione 4-(arylhydrazones), characterized by their triacetates. Reaction of 2 with HBr-HOAc gave 5-O-acetyl-6-bromo-6-deoxy-l-threo-2,3-hexodiulosono-1,4-lactone 2-(arylhydrazones); these were converted into 4-(2-O-acetyl-3-bromo-3-deoxy-l-threo-glycerol-l-yl)-2-aryl-1,2,3-triazole-5-carboxylic acid 5,4¹-lactones on treatment with acetic anhydride-pyridine.     

Effect of food-deprivation on rat pancreatic islet cells

Somatostatin, insulin and glucagon concentrations in rat pancreas were measured following various intervals of food-deprivation. Tissue concentrations, as measured by radioimmunoassay, were correlated with A-, B-, and D-cell number and size using a scanning integrating image analyzer (Quantimet 720). Alterations in total islet hormone content were not correlated to changes in size or distribution of cells. This implies that changes in tissue content reflect changes in turnover of peptides rather than changes in cell size or number.