Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.     

Metamorphic Changes in Glycolipids and Myelin Proteins and 2',3'-Cyclic Nucleotide 3'-Phosphohydrolase in Bullfrog and Axolotl Brains

Abstract: The metamorphic changes in levels of glycolipids and myelin proteins and 2',3'-cyclic nucleotide 3'-phosphohydrolase (CNP) in the brains of bullfrog tadpoles, adult frogs, and axolotls were investigated, with particular emphasis on myelin maturation. The concentrations of cerebroside. sulfatide, and galactosyldiacylglycerol gradually increased from the onset of prometamorphosis throughout the active metamorphic period and then greatly increased after metamorphosis was completed. The ratio of glucocerebroside to galactocerebroside increased greatly in the prometamorphic period and then rapidly decreased to the frog level during the climax period. The fatty acid compositions of cerebroside and sulfatide showed a developmental change, with 24:1 being more predominant in the later metamorphic stage. The proportion of hydroxy fatty acids increased up to the onset of the prometamorphic stage and thereafter remained constant at ∼ 50% of the total. The CNP activity remained unchanged throughout metamorphosis at 60% that in frog myelin and increased in the adult frog. The composition of tadpole myelin proteins remained constant during metamorphosis, with large basic protein being the most abundant, and in the frog, proteolipid protein and large basic protein were present in comparable amounts. The two adult forms of axolotl, i.e., the neotenous and metamorphosed forms, exhibited almost identical myelin constituents, and CNP activity in the neotenous form amounted to one-fifth that in the bullfrog. These results indicate that active biosynthesis of myelin marker components occurs as metamorphosis proceeds, but more pronounced changes of myelin components occur after metamorphosis is completed.     

Homologous recombination-mediated knock-in targeting of the MET1a gene for a maintenance DNA methyltransferase reproducibly reveals dosage-dependent spatiotemporal gene expression in rice

Although homologous recombination-promoted knock-in targeting to monitor the expression of a gene by fusing a reporter gene with its promoter is routine practice in mice, gene targeting to modify endogenous genes in flowering plants remains in its infancy. In the knock-in targeting, the junction sequence between a reporter gene and an endogenous target promoter can be designed properly, and transgenic plants carrying an identical and desired knock-in allele can be repeatedly obtained. By employing a reproducible gene-targeting procedure with positive–negative selection in rice, we were able to obtain fertile transgenic knock-in plants with the promoterless GUS reporter gene encoding β-glucuronidase fused with the endogenous promoter of MET1a , one of two rice MET1 genes encoding a maintenance DNA methyltransferase. All of the primary (T₀) transgenic knock-in plants obtained were found to carry only one copy of GUS , with the anticipated structure in the heterozygous condition, and no ectopic events associated with gene targeting could be detected. We showed the reproducible, dosage-dependent and spatiotemporal expression of GUS in the selfed progenies of independently isolated knock-in targeted plants. The results in knock-in targeted plants contrast sharply with the results in transgenic plants with the MET1a promoter -fused GUS reporter gene integrated randomly in the genome: clear interindividual variation of GUS expression was observed among independently obtained plants bearing the randomly integrated transgenes. As our homologous recombination-mediated gene-targeting strategy with positive–negative selection is, in principle, applicable to modify any endogenous gene, knock-in targeting would facilitate basic and applied plant research.     

FORTE: a profile-profile comparison tool for protein fold recognition

We present FORTE, a profile-profile comparison tool for protein fold recognition. Users can submit a protein sequence to explore the possibilities of structural similarity existing in known structures. Results are reported via email in the form of pairwise alignments.     

Naked gene therapy of hepatocyte growth factor for dextran sulfate sodium-induced colitis in mice

Ulcerative colitis (UC) is progressive and relapsing disease. To explore the therapeutic effects of naked gene therapy of hepatocyte growth factor (HGF) on UC, the SRalpha promoter driving HGF gene was intrarectally administered to the mice in which colitis was induced by dextran sulfate sodium (DSS). Expression of the transgene was seen in surface epithelium, lamina propria, and muscularis mucosae. The HGF-treated mice showed reduced colonic mucosal damage and increased body weights, compared with control mice (P < 0.01 and P < 0.05, respectively). The HGF-treated mice displayed increased number of PCNA-positive cells and decreased number of apoptotic cells than in control mice (P < 0.01, each). Phosphorylated AKT was dramatically increased after HGF gene administration, however, phosphorylated ERK1/2 was not altered. Microarray analysis revealed that HGF induced expression of proliferation- and apoptosis-associated genes. These data suggest that naked HGF gene delivery causes therapeutic effects through regulation of many downstream genes.     

Identification of a novel noninflammatory biosynthetic pathway of platelet-activating factor

Platelet-activating factor (PAF) is a potent lipid mediator playing various inflammatory and physiological roles. PAF is biosynthesized through two independent pathways called the de novo and remodeling pathways. Lyso-PAF acetyltransferase (lyso-PAF AT) was believed to biosynthesize PAF under inflammatory conditions, through the remodeling pathway. The first isolated lyso-PAF AT (LysoPAFAT/LPCAT2) had consistent properties. However, we show in this study the finding of a second lyso-PAF AT working under noninflammatory conditions. We partially purified a Ca(2+)-independent lyso-PAF AT from mouse lung. Immunoreactivity for lysophosphatidylcholine acyltransferase 1 (LPCAT1) was detected in the active fraction. Lpcat1-transfected Chinese hamster ovary cells exhibited both LPCAT and lyso-PAF AT activities. We confirmed that LPCAT1 transfers acetate from acetyl-CoA to lyso-PAF by the identification of an acetyl-CoA (and other acyl-CoAs) interacting site in LPCAT1. We further showed that LPCAT1 activity and expression are independent of inflammatory signals. Therefore, these results suggest the molecular diversity of lyso-PAF ATs is as follows: one (LysoPAFAT/LPCAT2) is inducible and activated by inflammatory stimulation, and the other (LPCAT1) is constitutively expressed. Each lyso-PAF AT biosynthesizes inflammatory and physiological amounts of PAF, depending on the cell type. These findings provide important knowledge for the understanding of the diverse pathological and physiological roles of PAF.     

Diversity of Plant Methionine Sulfoxide Reductases B and Evolution of a Form Specific for Free Methionine Sulfoxide

Methionine can be reversibly oxidized to methionine sulfoxide (MetO) under physiological conditions. Organisms evolved two distinct methionine sulfoxide reductase families (MSRA & MSRB) to repair oxidized methionine residues. We found that 5 MSRB genes exist in the soybean genome, including GmMSRB1 and two segmentally duplicated gene pairs (GmMSRB2 and GmMSRB5, GmMSRB3 and GmMSRB4). GmMSRB2 and GmMSRB4 proteins showed MSRB activity toward protein-based MetO with either DTT or thioredoxin (TRX) as reductants, whereas GmMSRB1 was active only with DTT. GmMSRB2 had a typical MSRB mechanism with Cys121 and Cys 68 as catalytic and resolving residues, respectively. Surprisingly, this enzyme also possessed the MSRB activity toward free Met-R-O with kinetic parameters similar to those reported for fRMSR from Escherichia coli, an enzyme specific for free Met-R-O. Overexpression of GmMSRB2 or GmMSRB4 in the yeast cytosol supported the growth of the triple MSRA/MSRB/fRMSR (Δ3MSRs) mutant on MetO and protected cells against H₂O₂-induced stress. Taken together, our data reveal an unexpected diversity of MSRBs in plants and indicate that, in contrast to mammals that cannot reduce free Met-R-O and microorganisms that use fRMSR for this purpose, plants evolved MSRBs for the reduction of both free and protein-based MetO.     

Monitoring expression profiles of Arabidopsis genes during cold acclimation and deacclimation using DNA microarrays

A comparative analysis of gene expression profiles during cold acclimation and deacclimation is necessary to elucidate the molecular mechanisms of cold stress responses in higher plants. We analyzed gene expression profiles in the process of cold acclimation and deacclimation (recovery from cold stress) using two microarray systems, the 7K RAFL cDNA microarray and the Agilent 22K oligonucleotide array. By both microarray analyses, we identified 292 genes up-regulated and 320 genes down-regulated during deacclimation, and 445 cold up-regulated genes and 341 cold down-regulated genes during cold acclimation. Many genes up-regulated during deacclimation were found to be down-regulated during cold acclimation, and vice versa. The genes up-regulated during deacclimation were classified into (1) regulatory proteins involved in further regulation of signal transduction and gene expression and (2) functional proteins involved in the recovery process from cold-stress-induced damages and plant growth. We also applied expression profiling studies to identify the key genes involved in the biosynthesis of carbohydrates and amino acids that are known to play important roles in cold acclimation. We compared genes that are regulated during deacclimation with those regulated during rehydration after dehydration to discuss the similarity and difference of each recovery process.Electronic Supplementary Material Supplementary materials are available for this article at