Less is more or more is less: Implications of glucose metabolism in the regulation of the reproductive potential and total lifespan of the Saccharomyces cerevisiae yeast

Carbohydrates are dietary nutrients that have an influence on cells physiology, cell reproductive capacity and, consequently, the lifespan of organisms. They are used in cellular processes after conversion to glucose, which is the primary source of energy and carbon skeleton for biosynthetic processes. Studies of the influence of glucose on cellular parameters and lifespan of organisms are primarily concerned with the effect of low glucose concentration defined as calorie restriction conditions. However, the effect of high glucose concentration on cell physiology is also very important. Thus, a comparative analysis of the effects of low and high glucose concentration conditions on cell efficiency was proposed with regard to reproductive capacity and total lifespan of the cell. Glucose concentration determines the type of metabolism and biosynthetic capabilities, which in turn, through the regulation on the cell size, may affect the reproductive capacity of cells. This study was conducted on yeast cells of wild-type and mutant strains Δgpa2 and Δgpr1 with glucose signalling pathway impairment. Such an experimental model enabled testing both the role of glucose concentration in the regulation of metabolic changes and the extent to which these changes depend on the extracellular or intracellular glucose concentrations. It has been shown here that calorie/glucose excess connected with changes in cell metabolic fluxes increases biosynthetic capabilities of yeast cells. This leads to an increase in cell dry weight accompanied by the increase in cell size and a simultaneous decrease in the reproductive potential and the overall length of cell life.     

Permian macroburrows as microhabitats for meiofauna organisms: an ancient behaviour common in extant organisms

Meiofaunal organisms are indirectly influenced by the activity of benthic macroinvertebrates within the sediment, which plays a role in modifying physical and chemical characteristics of the habitat. The association of meiofaunal organisms and macroburrows is well known in modern environments, but the record of this relationship in the geological record is still incipient. This study documents diminutive burrows (Helminthoidichnites tenuis) associated with the surface of macroburrows (Palaeophycus tubularis) in Early Permian deposits. The cylindrical shape and meandering to loop trajectory of the diminutive burrows indicate that they were produced by small free‐living meiofaunal nematodes. Apparently, P. tubularis (open burrow) constituted a favourable microhabitat for nematodes, providing the following: (1) protection against erosive processes and meiofauna predators; (2) oxygen access to more in‐depth layers within the sediment; (3) temperature stabilization; and (4) food supply due to mucus impregnation in the macroburrow walls by the Palaeophycus tracemaker. The association between H. tenuis and P. tubularis constitutes the first fossil record of a symbiotic relationship between meiofaunal nematodes and macrobenthic organisms (polychaetes). It also suggests that ecological strategies such as mutualism or commensalism, which are common between extant nematodes and macrobenthic invertebrates, were available in the behavioural programme of these organisms since the Early Permian.     

Low modularity and specialization in a commensalistic epiphyte–phorophyte network in a tropical cloud forest

Species interactions can shape the structure of natural communities. Such sets of interactions have been described as complex ecological networks, an example of which is the commensal network formed by epiphyte–phorophyte interactions. Vascular epiphytes germinate and grow on phorophytes (support trees), assuming a horizontal distribution (among the phorophyte species) and a vertical distribution (from the base of the tree trunk to the crown of phorophytes, i.e., through ecological zones). Here, we investigated the organization of these structural dimensions of the epiphyte–phorophyte network in a Brazilian tropical montane cloud forest. The analyzed network, comprising 66 epiphyte species and 22 phorophyte species, exhibited a nested structure with a low degree of specialization, a typical pattern for epiphyte–phorophyte networks in forests. The network was slightly modular, with 65% of the species common to three modules, and had vertical structure corresponding to the vertical organization of the phorophytes. The size (diameter at breast height) of phorophyte individuals influenced the network structure, possibly due to the increase in habitat area, the time available for colonization by epiphytes, and a greater number of microenvironments. We found that the distribution of the epiphyte species differed between the phorophyte ecological zones, with greater richness in the lower portions and greater abundance in the upper portions of the phorophytes. The results provide relevant guidance for future research on the characteristics and the vertical and horizontal organization of vascular epiphyte and phorophyte networks. Abstract in Portuguese is available with online material.     

Insulin adsorption onto zinc oxide nanoparticle mediates conformational rearrangement into amyloid-prone structure with enhanced cytotoxic propensity

Background

Injection localized amyloidosis is one of the most prevalent disorders in type II diabetes mellitus (TIIDM) patients relying on insulin injections. Previous studies have reported that nanoparticles can play a role in the amyloidogenic process of proteins. Hence, the present study deals with the effect of zinc oxide nanoparticles (ZnONP) on the amyloidogenicity and cytotoxicity of insulin.

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Computer-Assisted Discovery of Alkaloids with Schistosomicidal Activity

Schistosomiasis is a chronic parasitic disease caused by trematodes of the genus Schistosoma; it is commonly caused by Schistosoma mansoni, which is transmitted by Bioamphalaria snails. Studies show that more than 200 million people are infected and that more than 90% of them live in Africa. Treatment with praziquantel has the best cost–benefit result on the market. However, hypersensitivity, allergy, and drug resistance are frequently presented after administration. From this perspective, ligand-based and structure-based virtual screening (VS) techniques were combined to select potentially active alkaloids against S. mansoni from an internal dataset (SistematX). A set of molecules with known activity against S. mansoni was selected from the ChEMBL database to create two different models with accuracy greater than 84%, enabling ligand-based VS of the alkaloid bank. Subsequently, structure-based VS was performed through molecular docking using four targets of the parasite. Finally, five consensus hits (i.e., five alkaloids with schistosomicidal potential), were selected. In addition, in silico evaluations of the metabolism, toxicity, and drug-like profile of these five selected alkaloids were carried out. Two of them, namely, 11,12-methylethylenedioxypropoxy and methyl-3-oxo-12-methoxy-n(1)-decarbomethoxy-14,15-didehydrochanofruticosinate, had plausible toxicity, metabolomics, and toxicity profiles. These two alkaloids could serve as starting points for the development of new schistosomicidal compounds based on natural products.