Epithelial differentiation in the absence of extracellular matrix

Summary To investigate the regulation of epithelial differentiation, normal human epidermal keratinocytes were cultured floating on the surface of culture medium without attachment to a solid substrate. Keratinocytes spread out on the surface of the medium, proliferated and differentiated either into several flat lacy sheets 1 to 3 cells thick (on medium containing 0.15 mM calcium) or formed one single aggregate of cells from 5 to 15 cells in thickness on medium containing 1.15 mM calcium. The cell aggregates demonstrated a pattern of ordered epithelial differentiation. Levels of progressive differentiation resembling the structure of normal human epidermis were identified by light microscopy, immunohistochemistry, and electron microscopy. Differentiation proceeded from cells at the air side toward cells at the medium side with basal appearing cells on the air side and keratinocytes expressing filaggrin and involucrin on the side toward the medium. These results demonstrate that organized epithelial differentiation can occur in the absence of extracellular matrix. In contrast with other air-liquid interface cultures, epithelial differentiation in the absence of extracellular matrix progresses from air towards medium.     

Heparin-binding (fibroblast) growth factors are potential autocrine regulators of esophageal epithelial cell proliferation

Summary A serum-free culture system supplemented with neural tissue extract for normal and tumor human esophagi was applied to the culture of mouse esophageal epithelium. Similar to mouse mesenchyme and skin epithelium, esophageal epithelial lines (MEE) emerged after serial culture. The cells had an apparent unlimited life span but retained morphology and other characteristics of normal epithelial cells. The cells formed a small cyst consisting of keratined squamous epithelium in syngenic hosts. A screen for growth factors that stimulated growth of the nonmalignant MEE cells in the absence of neural extract revealed that epidermal growth factor (EGF) and heparin-binding (fibroblast) growth factors (HBGF) were most effective. An HBGF-like activity was apparent in extracts of rapidly proliferating but not quiescent MEE cells at low or confluent densities. A cloned cell line (MEE/C8) was selected from MEE cell cultures in the absence of neural extract. MEE/C8 cells proliferated independent of either EGF or HBGF at rates equal to MEE cells, cell extracts exhibited HBGF-like activity at all stages of proliferation, and the cells formed large invasive tumors in syngenic hosts. The HBGF-like activity present in extracts of tumorigenic MEE/C8 and proliferating nonmalignant MEE cells had properties similar to HBGF-1 (acidic fibroblast growth factor). These results constitute a cultured mouse esophageal epithelial cell model for study of conversion of immortalized premalignant cells to malignant cells, and suggest that conversion from a state of cell cycle-dependent autocrine expression of one or more members of the HBGF family to a state of constitutive expression correlates with and may contribute to malignancy. The work was supported in part by grants CA37589 and DK35310 to Dr. McKeehan, from the National Cancer Institute, Bethesda, MD.     

Electron-Microscopic Demonstration of a “Head and Stalk” Structure of the Leaf Vacuolar ATPase in Mesembryanthemum crystallinum L.

The structure of the vacuolar ATPase from mesophyll tonoplasts of Mesembryanthemum crystallinum has been studied by electron microscopy using negatively stained specimens of membrane-bound and detergent-solubilized ATPase molecules. We observed a high density of particles on the surface of tonoplast vesicles and “head and stalk” structures on the edge of the membrane, similar to the F₀F₁-ATPases of mitochondrial and chloroplast membranes. The staining conditions, which are often critical for such small objects, were improved by using methylamine tungstate as negative stain for the membrane-bound ATPase. Compared to other staining solutions generally applied, dissociation of the F₁-like enzyme complex from the membrane was best prevented and structural damage of the vesicles was least observed with methylamine tungstate. In freeze-fracture electron microscopy of tonoplast vesicles, where dissociation never occurs since no detergent is used, we also observed “head and stalk” structures on the edge of the membranes, beside many particles on the fracture faces. The detergent-solubilized ATPase forms string-like structures, caused by the aggregation of the hydrophobic membrane-embedded F₀-like part of the enzyme. After negative staining the F₁-like enzyme complex is arranged alternately along both sides of the string and connected by a narrow stalk.     

cis-4-Hydroxy-L-proline and ethyl-3,4-dihydroxybenzoate prevent myogenesis of C2C12 muscle cells and block MyoD1 and myogenin expression.

cis-4-Hydroxy-L-proline (cis-OH-Pro) and ethyl-3,4-dihydroxybenzoate (EDHB), two distinct inhibitors of collagen synthesis, prevented myogenesis in C2C12 mouse skeletal muscle cells. Both inhibitors blocked myotube formation and the expression of sarcomeric myosin heavy chain. Northern blot analysis showed that cis-OH-Pro- and EDHB-treated C2C12 muscle cells did not express the myogenic regulatory genes, MyoD1 and myogenin, but continued to express non-muscle isoforms of actin (beta and gamma) and alpha-tropomyosin. 10TFL2-3B cells, a C3H10T1/2 cell line permanently transfected with myogenin cDNA, constitutively expressed exogenous myogenin in the presence of cis-OH-Pro but failed to activate endogenous myogenin and to undergo myogenesis. These results demonstrate that commitment to terminal differentiation and activation of myogenic regulatory genes requires active synthesis of the extracellular matrix component collagen.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Studies on the hydrolysis of 3-methyl-2′-deoxycytidine in aqueous solution A synthesis of 3-methyl-2′-deoxyuridine

The hydrolysis of 3-methyl-2′-deoxycytidine in aqueous solution has been investigated. Varying proportions of 3-methylcytosine, 3-methyluracil and 3-methyl-2′-deoxyuridine are formed depending upon conditions of pH and temperature. All three hydrolytic products are formed at pH 6.8 and 90°C. At pH 2, depyrimidination of 3-methylcytosine occurs as the only hydrolysis product. When the pH is increased to 12, 3-methyl-2′-deoxycytidine on heating at 90°C is completely deaminated to 3-methyl-2′-deoxyuridine with few side products formed. This reaction serves as the basis for a convenient synthesis of 3-methyl-2′-deoxyuridine. The 300 MHz spectra of 3-methyl-2′-deoxycytidine and 3-methyl-2′-deoxyuridine indicate that the sugar ring in these compounds is predominantly in ²E conformation.     

Poliovirus Adsorption by 34 Minerals and Soils

The adsorption of radiolabeled infectious poliovirus type 2 by 34 well-defined soils and mineral substrates was analyzed in a synthetic freshwater medium containing 1 mM CaCl₂ and 1.25 mM NaHCO₃ at pH 7. In a model system, adsorption of poliovirus by Ottawa sand was rapid and reached equilibrium within 1 h at 4°C. Near saturation, the adsorption could be described by the Langmuir equation; the apparent surface saturation was 2.5 × 10⁶ plaque-forming units of poliovirus per mg of Ottawa sand. At low surface coverage, adsorption was described by the Freundlich equation. The soils and minerals used ranged from acidic to basic and from high in organic content to organic free. The available negative surface charge on each substrate was measured by the adsorption of a cationic polyelectrolyte, polydiallyldimethylammonium chloride. Most of the substrates adsorbed more than 95% of the virus. In general, soils, in comparison with minerals, were weak adsorbents. Among the soils, muck and Genesee silt loam were the poorest adsorbents; among the minerals, montmorillonite, glauconite, and bituminous shale were the least effective. The most effective adsorbents were magnetite sand and hematite, which are predominantly oxides of iron. Correlation coefficients for substrate properties and virus adsorption revealed that the elemental composition of the adsorbents had little effect on poliovirus uptake. Substrate surface area and pH, by themselves, were not significantly correlated with poliovirus uptake. A strong negative correlation was found between poliovirus adsorption and both the contents of organic matter and the available negative surface charge on the substrates as determined by their capacities for adsorbing the cationic polyelectrolyte, polydiallyldimethylammonium chloride.     

Decreased alpha 1-adrenoceptor responsiveness and density in liver cells of thyroidectomized rats

The effects of hypothyroidism on the hepatic alpha 1-receptor system were studied in isolated rat liver cells. Phenylephrine and vasopressin caused concentration-dependent activation of glycogen phosphorylase and release of 45Ca from 45Ca-loaded cells in either normal or thyroidectomized rats. However, the magnitude of both responses to phenylephrine was markedly suppressed after thyroidectomy and could be restored to near normal levels by in vivo treatment with 1-triiodothyronine (0.25 mg/kg/day) for 4 days. The potency of vasopressin to induce phosphorylase activation and 45Ca release was only slightly reduced by thyroidectomy. Binding of [3H]prazosin to putative alpha 1-receptors in purified liver plasma membranes revealed that the above changes were accompanied by a decrease in the density of binding sites from 567 +/- 51 fmol/mg of protein in controls to 326 +/- 51 fmol/mg in thyroidectomized rats and a return to 498 +/- 23 fmol/mg in thyroidectomized rats treated with 1-triiodothyronine. The affinity of binding sites for [3H]prazosin or for alpha-receptor agonists was the same in the three groups of rats and affinity for epinephrine was unaffected by the presence of guanyl-5'-yl imidodiphosphate (30-100 microM). From these findings, it appears that a reduction in the number of hepatic alpha 1-receptors is responsible for the selective decrease in alpha-adrenergic responses in the hypothyroid rat liver. These changes are opposite to those previously reported for hepatic beta-receptors.     

Nutritional requirements for conidial germination and hyphal growth of Beauveria bassiana

Nutritional requirements for germination and growth of the entomopathogenic fungus Beauveria bassiana are not complex. For germination to occur, a utilizable source of carbon must be present; however, a nitrogen source is needed for continued hyphal growth, otherwise lysis ensues. Compounds that can serve as utilizable carbon-energy sources for germination include glucose, N-acetylglucosamine, glucosamine, chitin, starch, lanolin, hydrocarbons in crude oil, and some longer-chain fatty acids. Both organic and inorganic sources of nitrogen are readily utilized for growth. Conidia undergo active metabolism soon after being placed in a suitable growth medium, indicating that conidia are released from their state of dormancy several hours before emergence of the germ tube can be observed. Because of the nutritional versatility of B. bassiana, this fungus should be able to survive and be infective in several types of natural environments.