Angiotensin II-dependent phosphorylation at Ser11/Ser18 and Ser938 shifts the E2 conformations of rat kidney Na+/K+-ATPase

Kidney plasma membranes, which contain a single α-1 isoform of Na+/K+-ATPase, simultaneously contain two sub-conformations of E2P, differing in their rate of digoxin release in response to Na+ and ATP. Treating cells with Ang II (angiotensin II) somehow changes the conformation of both, because it differentially inhibits the rate of digoxin release. In the present study we tested whether Ang II regulates release by increasing phosphorylation at Ser11/Ser18 and Ser938. Opossum kidney cells co-expressing the AT1a receptor and either α-1.wild-type, α-1.S11A/S18A or α-1.S938A were treated with or without 10?nM Ang II for 5?min, increasing phosphorylation at the three sites. Na+/K+-ATPase was bound to digoxin-affinity columns in the presence of Na+, ATP and Mg2+. A solution containing 30?mM NaCl and 3?mM ATP eluted ~20% of bound untreated Na+/K+-ATPase (Population #1). Pre-treating cells with Ang II slowed the elution of Population #1 in α-1.wild-type and α-1.S938A, but not α-1.S11A/S18A cells. Another 50% of bound Na+/K+-ATPase (Population #2) was subsequently eluted in two phases by a solution containing 150?mM NaCl and 3?mM ATP. Ang II increased the initial rate and slowed the second phase in α-1.wild-type, but not α-1.S938A, cells. Thus Ang II changes the conformation of two forms of EP2 via differential phosphorylation.     

Calcium/calmodulin inhibition of the Arabidopsis BRASSINOSTEROID-INSENSITIVE 1 receptor kinase provides a possible link between calcium and brassinosteroid signalling

The receptor kinase BRI1 (BRASSINOSTEROID-INSENSITIVE 1) is a key component in BR (brassinosteroid) perception and signal transduction, and has a broad impact on plant growth and development. In the present study, we demonstrate that Arabidopsis CaM (calmodulin) binds to the recombinant cytoplasmic domain of BRI1 in a Ca2+-dependent manner in vitro. In silico analysis predicted binding to Helix E of the BRI1 kinase subdomain VIa and a synthetic peptide based on this sequence interacted with Ca2+/CaM. Co-expression of CaM with the cytoplasmic domain of BRI1 in Escherichia coli strongly reduced autophosphorylation of BRI1, in particular on tyrosine residues, and also reduced the BRI1-mediated transphosphorylation of E. coli proteins on tyrosine, threonine and presumably serine residues. Several isoforms of CaM and CMLs (CaM-like proteins) were more effective (AtCaM6, AtCaM7 and AtCML8, where At is Arabidopsis thaliana) than others (AtCaM2, AtCaM4 and AtCML11) when co-expressed with BRI1 in E. coli. These results establish a novel assay for recombinant BRI1 transphosphorylation activity and collectively uncover a possible new link between Ca2+ and BR signalling.     

Individual differences in the effects of mobile phone exposure on human sleep: rethinking the problem

Mobile phone exposure‐related effects on the human electroencephalogram (EEG) have been shown during both waking and sleep states, albeit with slight differences in the frequency affected. This discrepancy, combined with studies that failed to find effects, has led many to conclude that no consistent effects exist. We hypothesised that these differences might partly be due to individual variability in response, and that mobile phone emissions may in fact have large but differential effects on human brain activity. Twenty volunteers from our previous study underwent an adaptation night followed by two experimental nights in which they were randomly exposed to two conditions (Active and Sham), followed by a full‐night sleep episode. The EEG spectral power was increased in the sleep spindle frequency range in the first 30 min of non‐rapid eye movement (non‐REM) sleep following Active exposure. This increase was more prominent in the participants that showed an increase in the original study. These results confirm previous findings of mobile phone‐like emissions affecting the EEG during non‐REM sleep. Importantly, this low‐level effect was also shown to be sensitive to individual variability. Furthermore, this indicates that previous negative results are not strong evidence for a lack of an effect and, given the far‐reaching implications of mobile phone research, we may need to rethink the interpretation of results and the manner in which research is conducted in this field. Bioelectromagnetics 33:86–93, 2012. © 2011 Wiley Periodicals, Inc.     

Coxiella burnetii infection of marine mammals in the Pacific Northwest, 1997-2010

Q fever is a zoonotic disease caused by the bacterium Coxiella burnetii. Humans are commonly exposed via inhalation of aerosolized bacteria derived from the waste products of domesticated sheep and goats, and particularly from products generated during parturition. However, many other species can be infected with C. burnetii, and the host range and full zoonotic potential of C. burnetii is unknown. Two cases of C. burnetii infection in marine mammal placenta have been reported, but it is not known if this infection is common in marine mammals. To address this issue, placenta samples were collected from Pacific harbor seals (Phoca vitulina richardsi), harbor porpoises (Phocoena phocoena), and Steller sea lions (Eumetopias jubatus). Coxiella burnetii was detected by polymerase chain reaction (PCR) in the placentas of Pacific harbor seals (17/27), harbor porpoises (2/6), and Steller sea lions (1/2) collected in the Pacific Northwest. A serosurvey of 215 Pacific harbor seals sampled in inland and outer coastal areas of the Pacific Northwest showed that 34.0% (73/215) had antibodies against either Phase 1 or Phase 2 C. burnetii. These results suggest that C. burnetii infection is common among marine mammals in this region.     

No evidence for transmission of antibiotic-resistant Escherichia coli strains from humans to wild western lowland gorillas in Lopé National Park, Gabon

The intensification of human activities within the habitats of wild animals is increasing the risk of interspecies disease transmission. This risk is particularly important for great apes, given their close phylogenetic relationship with humans. Areas of high human density or intense research and ecotourism activities expose apes to a high risk of disease spillover from humans. Is this risk lower in areas of low human density? We determined the prevalence of Escherichia coli antibiotic-resistant isolates in a population of the critically endangered western lowland gorilla (Gorilla gorilla gorilla) and other wild mammals in Lopé National Park (LNP), Gabon, and we tested whether the observed pattern could be explained by bacterial transmission from humans and domestic animals into wildlife populations. Our results show a high prevalence of antibiotic-resistant bacterial isolates in humans and low levels in gorillas and other wildlife. The significant differences in the genetic background of the resistant bacteria isolated from humans and gorillas suggest that transmission is low or does not occur between these two species. These findings indicate that the presence of antibiotic-resistant strains in wildlife do not imply direct bacteria transmission from humans. Thus, in areas of low human density, human-wildlife E. coli transmission seems to be low. The presence of antibiotic-resistant isolates in gorillas may be better explained by other mechanisms for resistance acquisition, such as horizontal gene exchange among bacteria or naturally acquired resistance.     

Okazaki fragment processing-independent role for human Dna2 enzyme during DNA replication

Dna2 is an essential helicase/nuclease that is postulated to cleave long DNA flaps that escape FEN1 activity during Okazaki fragment (OF) maturation in yeast. We previously demonstrated that the human Dna2 orthologue (hDna2) localizes to the nucleus and contributes to genomic stability. Here we investigated the role hDna2 plays in DNA replication. We show that Dna2 associates with the replisome protein And-1 in a cell cycle-dependent manner. Depletion of hDna2 resulted in S/G(2) phase-specific DNA damage as evidenced by increased γ-H2AX, replication protein A foci, and Chk1 kinase phosphorylation, a readout for activation of the ATR-mediated S phase checkpoint. In addition, we observed reduced origin firing in hDna2-depleted cells consistent with Chk1 activation. We next examined the impact of hDna2 on OF maturation and replication fork progression in human cells. As expected, FEN1 depletion led to a significant reduction in OF maturation. Strikingly, the reduction in OF maturation had no impact on replication fork progression, indicating that fork movement is not tightly coupled to lagging strand maturation. Analysis of hDna2-depleted cells failed to reveal a defect in OF maturation or replication fork progression. Prior work in yeast demonstrated that ectopic expression of FEN1 rescues Dna2 defects. In contrast, we found that FEN1 expression in hDna2-depleted cells failed to rescue genomic instability. These findings suggest that the genomic instability observed in hDna2-depleted cells does not arise from defective OF maturation and that hDna2 plays a role in DNA replication that is distinct from FEN1 and OF maturation.     

Diagnostic and therapeutic dilemma associated with atypical glandular cells on liquid‐based cervical cytology

K. Chummun, M. Fitzpatrick, P. Lenehan, P. Boylan, E. Mooney and G. Flannelly
Diagnostic and therapeutic dilemma associated with atypical glandular cells on liquid‐based cervical cytology Background: In 2008, the management of women in Ireland with atypical glandular cells changed to immediate referral to colposcopy. The optimal management of these women is unclear. A balance between the detection of occult disease and overtreatment is required. Methods: Our study aim was to document the experience of this policy at the National Maternity Hospital, Dublin. Information from the computerized data management system was analysed with the statistical package SPSS. Results: In 2009, 156 women attended colposcopy following a single atypical glandular cell diagnosis on liquid‐based cytology. The mean age was 41 years. Thirty (19.2%) women had abnormal vaginal bleeding, 31 (19.9%) were smokers and 34 (21.8%) had received previous treatment. The colposcopy was satisfactory in 125 (80.1%) and unsatisfactory in 31 (19.9%). Cervical histology was available for 146 (93.6%) women: 57 excisional procedures and 89 diagnostic biopsies. Abnormal histology was detected in 46 women (31.5%). Four women (2.7%) had invasive cancer, five (3.4%) had adenocarcinoma in situ, 21 (14.4%) had cervical intraepithelial neoplasia (CIN) grade 2 or 3 and 16 (11.0%) had CIN1. No abnormality was detected in 100 women (68.5%), including 35 (61.4%) of those who had undergone excisional procedures. The colposcopic impression in this group was unsatisfactory in 10 women (28.6%), glandular abnormalities in six (17.1%), high‐ and low‐grade changes in 12 (34.2%) and six (17.1%) women, respectively, and normal in one (2.9%). The findings were essentially negative in the remaining 10 women: overall, 30 (19.2%) of the 156 women referred to colposcopy had at least CIN2. Conclusion: This study confirmed significant levels of high‐grade disease in women referred to colposcopy with atypical glandular cells on cytology. Concerns about undetected endocervical disease resulted in high levels of negative excisional biopsies. Alternative strategies, including endometrial sampling, human papillomavirus testing and discussion at clinicopathological meeting, should be considered.     

Successive virgin births of viable male progeny in the checkered gartersnake,Thamnophis marcianus

In recent years genotyping analysis using mini‐ and microsatellite markers has provided robust DNA‐based support for facultative parthenogenesis (FP) in several lineages of squamate reptiles (snakes and lizards) and sharks. Rather than incidental cases of reproductive error, there is growing evidence that FP is an alternative reproductive strategy and an important mode of reproduction in these phylogenetically divergent vertebrate groups. Because documentation of FP in vertebrates is in its infancy, additional instances supported by molecular genetic methods provide insights that advance our general understanding of this phenomenon. Here, in a female checkered gartersnake (Thamnophis marcianus) reared in isolation since a juvenile, we describe five successive parthenogenetic litters produced over a 7‐year period that resulted in several viable male progeny. Cross species microsatellite amplification was performed across 30 primer pairs derived from Thamnophis spp. and related natricines to the female and nine available progeny. Five loci proved heterozygous in the maternal sample with the progeny differentially homozygous at all but one locus. Combined with evidence pertaining to captive history and litter characteristics, our analysis supports a specific type of FP, terminal fusion automictic parthenogenesis, over the competing hypothesis of long‐term sperm storage. Importantly, we document that a single individual was capable of producing successive litters composed of live parthenogens. In two cases, males achieved adulthood and showed the anatomical potential to demonstrate reproductive competence (normal looking hemipenes and testes). © 2012 The Linnean Society of London, Biological Journal of the Linnean Society, 2012, 107 , 566–572.     

Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n=51) and cancer free controls (n=88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [(32)P]-based oligonucleotide cleavage assay (MPG substrate 5'-CCGCT?AGCGGGTACCGAGCTCGAAT; ?A=ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21±1.67fmol/μg DNA/h vs 3.47±1.35fmol/μg DNA/h, p=0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.