Diachronic changes in two eastern lowland gorilla groups (Gorilla gorilla graueri) in the Mt. Kahuzi Region,Zaïre

The diachronic changes of two gorilla groups in the Kahuzi region are studied. The death of a leader male resulted in the size changes of the two groups. Both groups' ranging areas and patterns are compared with former reports. Inter-group relationships, intra-group interactions and files of procession are described. The social organization and female transfer system of gorillas are discussed, and an explanation for infanticide is presented.     

Restriction Enzyme-Resistant High Molecular Weight Telomeric DNA Fragments in Tobacco

Restriction endonuclease-resistant high-molecular-weight (HMW)DNA fragments were isolated from nuclear DNA fragments in tobacco.The size of the fragments produced by EcoRI, HindIII, AfaI,and HaeIII ranged from 20 kb to over 166 kb. The kinetics ofdigestion by Bal31 nuclease showed that most of the HMW fragmentsare chromosome ends. The consensus sequence for tobacco telomererepeats was determined to be CCCTAAA by genomic sequencing usingthe HMW fragments and by sequencing after cloning. Besides thetelomere sequence, 9 tandem repeats of a 45-bp sequence wereidentified, in which a 35-bp unit sequence (AGTCAGCATTAGGGTTTTAAACCCTAAACTGAACT)formed a stem structure. The front of the stem is composed ofa palindrome of the telomere repeats. This highly conservedunit is surrounded by less conserved internal sequences thatare around 10–11 bp in size and contain a TTTT stretch.The internal sequences resemble the 10–11 bp consensusfor the scaffold attachment regions found in yeast and drosophila.The characteristic 45-bp sequence was abundant on the ends ofchromosomes. The shortest distance between the repeats containingtelomeric stem and the telomere was less than 20 kb. This architectureof the tobacco chromosome end region resembles the end regionof yeast chromosomes in which autonomous replication sequencesare present frequently.     

Ethanol production by encapsulated and immobilized yeast

Summary Immobilized yeast was encapsulated with cell-free calciumalginate gel by two-step preparation procedure. The volume of coated film decreased with increasing cell concentration. The encapsulation did not affect ethanol production and could prevent cell leakage from the gels.     

Status of large mammals in the mountain sector of Kahuzi-Biega National Park, Democratic Republic of Congo, in 1996

Kahuzi-Biega National Park, located in eastern Democratic Republic of Congo, harbours an abundance of endemic species and maintains important populations of Grauer's gorilla ( Gorilla gorilla graueri ) and elephants ( Loxodonta africana ). This paper reports on the status of large mammals within the mountain sector of the park in 1996, 2 years after the arrival of half a million Rwandan refugees in the area immediately adjacent to the sector. Large mammal surveys found that gorilla populations had remained stable and that elephants were concentrated within a subsector of the area. However, although chimpanzees ( Pan troglodytes ), blue monkeys ( Cercopithecus mitis ), and owl-faced monkeys ( C. hamlyni ) were abundant and widespread, most terrestrial mammal species were found in very low densities and had been subjected to poaching. Nevertheless, important mammal populations remained and complemented the biodiversity conservation value of the park.