Production of the plant polyketide curcumin in Aspergillus oryzae: strengthening malonyl-CoA supply for yield improvement

The filamentous fungus Aspergillus oryzae was recently used as a heterologous host for fungal secondary metabolite production. Here, we aimed to produce the plant polyketide curcumin in A. oryzae. Curcumin is synthesized from feruloyl-coenzyme A (CoA) and malonyl-CoA by curcuminoid synthase (CUS). A. oryzae expressing CUS produced curcumin (64 μg/plate) on an agar medium containing feruloyl-N-acetylcysteamine (a feruloyl-CoA analog). To increase curcumin yield, we attempted to strengthen the supply of malonyl-CoA using two approaches: enhancement of the reaction catalyzed by acetyl-CoA carboxylase (ACC), which produces malonyl-CoA from acetyl-CoA, and inactivation of the acetyl-CoA-consuming sterol biosynthesis pathway. Finally, we succeeded in increasing curcumin yield sixfold by the double disruption of snfA and SCAP; SnfA is a homolog of SNF1, which inhibits ACC activity by phosphorylation in Saccharomyces cerevisiae and SCAP is positively related to sterol biosynthesis in Aspergillus terreus. This study provided useful information for heterologous polyketide production in A. oryzae.     

Downregulation of lncRNA APCDD1L-AS1 due to DNA hypermethylation and loss of VHL protein expression promotes the progression of clear cell renal cell carcinoma

Background: The current studies only indicated that long non-coding RNA (lncRNA) APCDD1L-AS1, as a novel lncRNA, may play a role in oral squamous cell carcinoma and lung cancer. However, its potential role in clear cell renal cell carcinoma (ccRCC) and its possible mechanism of action remain vague.Methods: TCGA-KIRC and GEO data and qRT-PCR and pyrosequencing results of clinical specimens were used to identify the expression level and DNA methylation status of APCDD1L-AS1. The effects of APCDD1L-AS1 overexpression on ccRCC growth and metastasis were determined by function experiments. Western blot and Tandem mass tags (TMT) were utilized to explore the relationship between APCDD1L-AS1 and VHL expression and its downstream underlying mechanisms.Results: The expression of APCDD1L-AS1 was downregulated in ccRCC. Decreased APCDD1L-AS1 expression was related to higher tumor stage and histological grade and shorter RFS (Relapse-free survival). Besides, APCDD1L-AS1 overexpression restrained the growth and metastasis of ccRCC cells in vitro and in vivo. Moreover, reduced APCDD1L-AS1 expression could be caused by DNA hypermethylation and loss of von Hippel Lindau (VHL) protein expression. Furthermore, the dysregulation of histones expression caused by APCDD1L-AS1 overexpression may be one of the important mechanisms to suppress the progression of ccRCC.Conclusion: APCDD1L-AS1 was able to inhibit the progression of ccRCC, and its decreased expression could be caused by DNA hypermethylation and loss of VHL protein expression. Therefore, APCDD1L-AS1 may serve as a new therapeutic target in the treatment of ccRCC.     

Thin-layer chromatography and high-performance liquid chromatography for the assay of fatty acid compositions of individual phospholipids in platelets from non-insulin-dependent diabetes mellitus patients: effect of eicosapentaenoic acid ethyl ester administration

Eight major phospholipids were separated by a TLC method with a one-dimensional developing system without any pretreatment of the plate and the fatty acids incorporated into each phospholipid class were analysed by an improved HPLC method with a simple elution system, which has advantages with respect to resolution and analysis time. The fatty acid compositions of individual phospholipids in platelets were investigated following administration of ethyl cis-5,8,11,14,17-eicosapentaenoate for more than 13 weeks to patients with non-insulin-dependent diabetes mellitus. The cis-5,8,11,14,17-eicosapentaenoic acid compositions of all phospholipid classes were significantly increased with decreasing platelet aggregation rates after the administration. These results suggested that the present method provides the complete separation of individual phospholipids in sufficient amounts to allow fatty acid analysis on the isolated phospholipid moieties.     

Ligand-dependent and -independent interactions with the transforming growth factor type II and I receptor subunits reside in the aminoterminal portion of the ectodomain of the type III subunit

Summary The type III receptor for transforming growth factor beta (TGFβ), which exhibits no kinase activity, binds TGFβ1 and TGFβ2 and is involved in assembly and activity of the multi-subunit TGFβ signal transduction complex. Recently we showed that TGFβ receptor type III (TβRIII) can participate in a complex composed of the dimeric TGFβ ligand and a type III, II, and I receptor subunit. The interaction of the TβRIII subunit with TβRII is TGFβ-dependent, whereas interaction with TβRI is TGFβ-independent. Here we use coexpression of the three types of TGFβ receptors in baculoviral-infected insect cells to determine which parts of the unglycosylated TβRIII receptor participate in the binding of TGFβ, the TGFβ-dependent interaction with TβRII and the TGFβ-independent interaction with TβRI. The results suggest that the first 500 amino acid residues in the aminoterminal portion of TβRIII exhibit all three properties.     

Genetic variation in parthenogenetic Caucasian rock lizards of the genus Lacerta (L. dahli, L. armeniaca, L. unisexualis) analyzed by DNA fingerprinting

Multilocus DNA fingerprinting has been used to study the variability of some mini- and microsatellite sequences in parthenogenetic species of Caucasian rock lizards of the genus Lacerta (L. dahli, L. armeniaca and L. unisexualis). We demonstrate that these clonally reproducing lizards possess species-specific DNA fingerprints with a low degree of intra- and interpopulation variation. Mean indices of similarity obtained using M13 DNA, (GACA)4 and (TCC)50 as probes were 0.962 and 0.966 in L. dahli and L. armeniaca, respectively. The mean index of similarity obtained using M 13 and GATA probes in L. unisexualis was estimated to be 0.95. However, despite the high degree of band-sharing, variable DNA fragments were revealed in all populations with the microsatellite probes. An particularly high level of variability was observed for (TCC)n microsatellites in populations of L. unisexualis. In fact TCC-derived DNA fingerprints were close to being individual-specific, with a mean index of similarity of 0.824. Fingerprint analysis of parthenogenetic families of L. armeniaca showed that all maternal fragments were inherited together by the progeny, and no differences in fingerprint patterns were observed. On the other hand, while identical DNA fingerprints were obtained from L. unisexualis families with M13 and (GATA)4 probes, use of the (TCC)50 probe revealed remarkable intrafamily variation in this species. It is assumed that the genetic heterogeneity observed in parthenogenetic populations may be explained, at least in part, by the existence of genetically unstable microsatellite loci. Our data serve to illustrate processes of spontaneous mutagenesis and the initial stages of clonal differentiation in natural populations of the lizard species studied.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Whisker-mediated plant transformation: An alternative technology

A number of different methods, involving direct DNA delivery are now available for plant transformation. Here we review the most recently developed technique which involves the mixing of silicon carbide whiskers with plant cells and plasmid DNA. Fertile transgenic plants have now been produced using whisker-mediated transformation, and this method can now be considered as a simple, inexpensive alternative for plant transformation. A brief review on transformation of animal cells andChlamydomonas using whiskers technology is also included.     

Quorum Sensing Enhances the Stress Response in Vibrio cholerae

Vibrio cholerae lives in aquatic environments and causes cholera. Here, we show that quorum sensing enhances V. cholerae viability under certain stress conditions by upregulating the expression of RpoS, and this regulation acts through HapR, suggesting that a quorum-sensing-enhanced stress response plays a role in V. cholerae environmental survival.     

Effect of sunflower seed oil emollient therapy on newborn infant survival in Uttar Pradesh,India: A community-based,cluster randomized,open-label controlled trial

BackgroundHospitalized preterm infants with compromised skin barrier function treated topically with sunflower seed oil (SSO) have shown reductions in sepsis and neonatal mortality rate (NMR). Mustard oil and products commonly used in high-mortality settings may possibly harm skin barrier integrity and enhance risk of infection and mortality in newborn infants. We hypothesized that SSO therapy may reduce NMR in such settings.Methods and findingsThis was a population-based, cluster randomized, controlled trial in 276 clusters in rural Uttar Pradesh, India. All newborn infants identified through population-based surveillance in the study clusters within 7 days of delivery were enrolled from November 2014 to October 2016. Exclusive, 3 times daily, gentle applications of 10 ml of SSO to newborn infants by families throughout the neonatal period were recommended in intervention clusters (n = 138 clusters); infants in comparison clusters (n = 138 clusters) received usual care, such as massage practice typically with mustard oil. Primary analysis was by intention-to-treat with NMR and post-24-hour NMR as the primary outcomes. Secondary analysis included per-protocol analysis and subgroup analyses for NMR. Regression analysis was adjusted for caste, first-visit weight, delivery attendant, gravidity, maternal age, maternal education, sex of the infant, and multiple births. We enrolled 13,478 (52.2% male, mean weight: 2,575.0 grams ± standard deviation [SD] 521.0) and 13,109 (52.0% male, mean weight: 2,607.0 grams ± SD 509.0) newborn infants in the intervention and comparison clusters, respectively. We found no overall difference in NMR in the intervention versus the comparison clusters [adjusted odds ratio (aOR) 0.96, 95% confidence interval (CI) 0.84 to 1.11, p = 0.61]. Acceptance of SSO in the intervention arm was high at 89.3%, but adherence to exclusive applications of SSO was 30.4%. Per-protocol analysis showed a significant 58% (95% CI 42% to 69%, p < 0.01) reduction in mortality among infants in the intervention group who were treated exclusively with SSO as intended versus infants in the comparison group who received exclusive applications of mustard oil. A significant 52% (95% CI 12% to 74%, p = 0.02) reduction in NMR was observed in the subgroup of infants weighing ≤1,500 g (n = 589); there were no statistically significant differences in other prespecified subgroup comparisons by low birth weight (LBW), birthplace, and wealth. No severe adverse events (SAEs) were attributable to the intervention. The study was limited by inability to mask allocation to study workers or participants and by measurement of emollient use based on caregiver responses and not actual observation.ConclusionsIn this trial, we observed that promotion of SSO therapy universally for all newborn infants was not effective in reducing NMR. However, this result may not necessarily establish equivalence between SSO and mustard oil massage in light of our secondary findings. Mortality reduction in the subgroup of infants ≤1,500 g was consistent with previous hospital-based efficacy studies, potentially extending the applicability of emollient therapy in very low-birth-weight (VLBW) infants along the facility–community continuum. Further research is recommended to develop and evaluate therapeutic regimens and continuum of care delivery strategies for emollient therapy for newborn infants at highest risk of compromised skin barrier function.Trial registrationISRCTN Registry ISRCTN38965585 and Clinical Trials Registry—India (CTRI/2014/12/005282) with WHO UTN # U1111-1158-4665.

In a cluster randomized trial, Aarti Kumar and colleagues study the effectiveness of a topical sunflower seed oil therapy in reducing neonatal mortality in Uttar Pradesh, India.