Synthesis, biological evaluation and molecular docking studies of stellatin derivatives as cyclooxygenase (COX-1, COX-2) inhibitors and anti-inflammatory agents

Stellatin (4), isolated from Dysophylla stellata is a cyclooxygenase (COX) inhibitor. The present study reports the synthesis and biological evaluation of new stellatin derivatives for COX-1, COX-2 inhibitory and anti-inflammatory activities. Eight derivatives showed more pronounced COX-2 inhibition than stellatin and, 17 and 21 exhibited the highest COX-2 inhibition. They also exhibited the significant anti-inflammatory activity in TPA-induced mouse ear edema assay and their anti-inflammatory effects were more than that of stellatin and indomethacin at 0.5 mg/ear. The derivatives were further evaluated for antioxidant activity wherein 16 and 17 showed potent free radical scavenging activity against DPPH and ABTS radicals. Molecular docking study revealed the binding orientations of stellatin and its derivatives into the active sites of COX-1 and COX-2 and thereby helps to design the potent inhibitors.     

Effect of high temperature and water stress on in vitro germination and growth in isolates of the entomopathogenic fungus Beauveria bassiana (Bals.) Vuillemin

In non-irrigated agricultural fields in tropical zones, high temperature and water stress prevail during the main cropping season. Natural epizootics of Beauveria bassiana on lepidopteran pests occur during winter. Application of B. bassiana during hot months when pest populations are at their climax may prove an effective management strategy. Therefore, 29 isolates of B. bassiana were tested for their ability to germinate and grow in temperature and water availability conditions prevailing during the pest season in these fields. The effect of temperature cycles with 8 h duration of high temperature fluctuating with 16 h duration of lower temperature (similar to field conditions); low water availability; and a combination of these two stress conditions was studied. Germination and growth assays were done at fluctuating temperature cycles of 32, 35, 38, and 42+/-1 degrees C (8 h)/25+/-1 degrees C (16 h) and in media with water stress created by 10, 20, 30, and 40% polyethylene glycol (PEG 6000). Assays set at a continuous temperature of 25+/-1 degrees C with no PEG in the medium served as controls. Stress was assessed as percentage germination or as growth relative to control. Isolates showing 90% growth relative to the control at temperature cycles including high temperatures of 35 and 38+/-1 degrees C were identified. One isolate (ARSEF 2860) had a thermal threshold above 43 degrees C. At 25 degrees C, all but one isolate of B. bassiana showed >90% growth relative to the control in 10% PEG (-0.45 MPa). Some isolates were found with >90% growth relative to control in medium having 30% PEG with water availability (1.33 MPa), nearly equivalent to that in soils which induce permanent wilting point of plants. When isolates that showed >90% growth relative to the control at both stress conditions, were stressed simultaneously, a decrease in growth was observed. Growth was reduced by approximately 20% at 35+/-1 degrees C (8 h)/25+/-1 degrees C (16 h) and 10% PEG and was affected to a greater degree in combinations of harsher stress conditions. The isolate ARSEF 2860 with a thermal threshold of >43 degrees C showed approximately 80% relative growth at a combined stress of 38+/-1 degrees C (8 h)/25+/-1 degrees C (16 h) and 10% PEG. These findings will aid the selection of isolates for use in field trials in hot or dry agricultural climates.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

Characterization of Insect Proteinases and Their Inhibition by Finger and Little Millet Inhibitors

Empirical approach was adopted to examine the interaction of a little and finger millet inhibitors with digestive proteinases ofdifferent field and storage pests. Accordingly, gut proteinases of four storage and phytophagous pests were characterized andtheir inhibition by finger millet (Eluesine coracana Gaertneri) and little millet (Panicum sumatrense Roth) inhibitors has beeninvestigated. The Callosobruchus sp showed acid proteinase with pH optimum of 3.5 and Sitophilus oryzae showed pHoptimum of 4.5 apart from their alkaline proteinases with pH 8.5. The proteinases of Tribolium castaneum had wider pHoptimum from 5.5 to 8.5. However, all lepidopteran insect proteinases had pH optima ranging from 8.5 to 10.5. The optimumtemperature was found to be 30 to 40 °C. The inhibitory activities of little and finger millet inhibitors towards the insectproteinases are very low except notable level inhibition of proteinases of some insects. The gut proteinase zymogram ofdifferent insects revealed 2 – 6 isozymes and the inhibitors moderately inhibited all the isozymes of insects tested.     

Intronic enhancement of angiotensin II type 2 receptor transgene expression in vitro and in vivo

The angiotensin II type 2 receptor (AT2R) can influence a variety of intracellular signaling molecules and cellular functions. However, its physiological functions and the roles of introns in the regulation of its expression have not been well determined. We first demonstrated that both intron 1 and intron 2 of AT2R could significantly enhance AT2R overexpression. Thus, we have provided some new prerequisites for further studies on the mechanisms that control AT2R gene expression. Next, we established a highly efficient method of delivering this receptor in vitro and in vivo using an AT2R recombinant adenoviral vector containing two introns of the AT2R. The vector may be useful in helping to uncover AT2R physiological functions and also for gene therapy related to AT2R. Moreover, we determined the important role of introns in gene expression cassettes and the inconsistency of expression between the targeted gene and the reporter gene.     

CHEMICAL MODIFICATION OF L-ASPARAGINASE FROM Cladosporium sp. FOR IMPROVED ACTIVITY AND THERMAL STABILITY

L-Asparaginase (ASNase), an antileukemia enzyme, is facing problems with antigenicity in the blood. Modification of L-asparaginase from Cladosporium sp. was tried to obtain improved stability and improved functionality. In our experiment, modification of the enzyme was tried with bovine serum albumin, ovalbumin by crosslinking using glutaraldehyde, N-bromosuccinimide, and mono-methoxy polyethylene glycol. Modified enzymes were studied for activity, temperature stability, rate constants (k_d), and protection to proteolytic digestion. Modification with ovalbumin resulted in improved enzyme activity that was 10-fold higher compared to native enzyme, while modification with bovine serum albumin through glutaraldehyde cross-linking resulted in high stability of L-asparaginase that was 8.5- and 7.62-fold more compared to native enzyme at 28°C and 37°C by the end of 24 hr. These effects were dependent on the quantity of conjugate formed. Modification also markedly prolonged L-asparaginase half-life and serum stability. N-Bromosuccinimide-modified ASNase presented greater stability with prolonged in vitro half-life of 144 hr to proteolytic digestion relative to unmodified enzyme (93 h). The present work could be seen as producing a modified L-asparaginase with improved activity and stability and can be a potential source for developing therapeutic agents for cancer treatment.     

Epistatic role of base excision repair and mismatch repair pathways in mediating cisplatin cytotoxicity

Base excision repair (BER) and mismatch repair (MMR) pathways play an important role in modulating cis-Diamminedichloroplatinum (II) (cisplatin) cytotoxicity. In this article, we identified a novel mechanistic role of both BER and MMR pathways in mediating cellular responses to cisplatin treatment. Cells defective in BER or MMR display a cisplatin-resistant phenotype. Targeting both BER and MMR pathways resulted in no additional resistance to cisplatin, suggesting that BER and MMR play epistatic roles in mediating cisplatin cytotoxicity. Using a DNA Polymerase β (Polβ) variant deficient in polymerase activity (D256A), we demonstrate that MMR acts downstream of BER and is dependent on the polymerase activity of Polβ in mediating cisplatin cytotoxicity. MSH2 preferentially binds a cisplatin interstrand cross-link (ICL) DNA substrate containing a mismatch compared with a cisplatin ICL substrate without a mismatch, suggesting a novel mutagenic role of Polβ in activating MMR in response to cisplatin. Collectively, these results provide the first mechanistic model for BER and MMR functioning within the same pathway to mediate cisplatin sensitivity via non-productive ICL processing. In this model, MMR participation in non-productive cisplatin ICL processing is downstream of BER processing and dependent on Polβ misincorporation at cisplatin ICL sites, which results in persistent cisplatin ICLs and sensitivity to cisplatin.     

Evolution of larval segment position across 12 Drosophila species*

Many developmental traits that are critical to the survival of the organism are also robust. These robust traits are resistant to phenotypic change in the face of variation. This presents a challenge to evolution. In this article, we asked whether and how a well-established robust trait, Drosophila segment patterning, changed over the evolutionary history of the genus. We compared segment position scaled to body length at the first-instar larval stage among 12 Drosophila species. We found that relative segment position has changed many times across the phylogeny. Changes were frequent, but primarily small in magnitude. Phylogenetic analysis demonstrated that rates of change in segment position are variable along the Drosophila phylogenetic tree, and that these changes can occur in short evolutionary timescales. Correlation between position shifts of segments decreased as the distance between two segments increased, suggesting local control of segment position. The posterior-most abdominal segment showed the highest magnitude of change on average, had the highest rate of evolution between species, and appeared to be evolving more independently as compared to the rest of the segments. This segment was exceptionally elongated in the cactophilic species in our dataset, raising questions as to whether this change may be adaptive.