Characterization of the str operon genes from Spirulina platensis and their evolutionary relationship to those of other prokaryotes

Summary A 5.3 kb DNA segment containing the str operon (ca. 4.5 kb) of the cyanobacterium Spirulina platensis has been sequenced. The str operon includes the structural genes rpsL (ribosomal protein S12), rpsG (ribosomal protein S7), fus (translation elngation factor EF-G) and tuf (translation elongation factor EF-Tu). From the nucleotide sequence of this operon, the primary structures of the four gene products have been derived and compared with the available corresponding structures from eubacteria, archaebacteria and chloroplasts. Extensive homologies were found in almost all cases and in the order S12>EF-Tu>EF-G>S7; the largest homologies were generally found between the cyanobacterial proteins and the corresponding chloroplast gene products. Overall codon usage in S. platensis was found to be rather unbiased.     

Membrane Potential and Catecholamine Secretion by Bovine Adrenal Chromaffin Cells: Use of Tetraphenylphosphonium Distribution and Carbocyanine Dye Fluorescence

Changes in plasma membrane potential of isolated bovine adrenal chromaffin cells were measured independently by two chemical probe methods and related to corresponding effects on catecholamine secretion. The lipophilic cation tetraphenylphosphonium (TPP+) and the carbocyanine dye 3,3'-dipropylthiadicarbocyanine [DiS-C3-(5)] were used. The necessity of evaluating the subcellular distribution of TPP+ among cytoplasmic, mitochondrial, secretory granule, and bound compartments was demonstrated and the resting plasma membrane potential determined to be -55 mV. The relationship between membrane potential and catecholamine secretion was determined in response to variations in extracellular K+ and to the presence of several secretagogues including cholinergic receptor ligands, veratridine, and ionophores for Na+ and K+. The dependence of potential on K+ concentration fit the Goldman constant field equation with a Na/K permeability ratio of 0.1. The dependence of both K+- and veratridine-evoked catecholamine secretion on membrane potential exhibited a potential threshold of about -40 mV before a significant rise in secretion occurred. This is likely related to the threshold for opening of voltage-sensitive Ca2+ channels. Acetylcholine and nicotine evoked a large secretory response without a sufficiently sustained depolarization to be detectable by the relatively slow potential sensitive chemical probes. Decamethonium induced a detectable depolarization of the chromaffin cells. Veratridine and gramicidin evoked both membrane depolarization and catecholamine release. By contrast the K ionophore valinomycin evoked significant levels of secretion without any depolarization. This is consistent with its utilization of an intracellular source of Ca2+ and the independence of its measured secretory response on extracellular Ca2+.     

The Na-K-Cl cotransporter of avian salt gland. Phosphorylation in response to cAMP-dependent and calcium-dependent secretogogues.

The effect of a cAMP-dependent secretogogue (VIP) on the phosphorylation of an endogenous, membrane-bound protein (pp170) was assessed in an intact cell preparation from the avian salt gland. The addition of VIP, in the presence of 100 microM isobutylmethylxanthine, resulted in a concentration-dependent increase in phosphorylation of pp170. This effect was rapid and transient with a 3-5-fold increase in phosphorylation occurring 1 min after the addition of VIP. Under similar incubation conditions, VIP stimulated a 4.6-fold increase in cAMP accumulation that paralleled phosphorylation. Exposure of cells to either forskolin or 8-Br-cAMP resulted in a 5-8-fold increase in the phosphorylation of pp170. The effect of forskolin was dose dependent with an EC50 similar to that for stimulation of secretion (35 nM). These results implicate an involvement for a cAMP-dependent protein kinase in the phosphorylation of pp170. The identity of pp170 was assessed utilizing a monoclonal antibody (Q3) directed against pp170. Q3 recognized a single 170-kDa band on Western blots of salt gland membrane protein. Immunoprecipitation of pp170 from salt gland cells resulted in the selective extraction of a single protein whose phosphorylation state was increased approximately 5-fold in response to carbachol or VIP. The identity of pp170 was established using two criteria. First, Q3 recognized affinity-purified Na:K:Cl cotransporter preparations from shark rectal gland membranes. Second, pp170 was selectively immunoprecipitated by monoclonal antibodies (J3, J4, and J7) that recognize different epitopes of the shark transport protein. These results suggest that pp170 is homologous to the shark rectal gland Na-K-Cl cotransporter, and thus the proteins may be functionally similar.     

Modification of guanine bases by nucleoside phosphoramidite reagents during the solid phase synthesis of oligonucleotides.

Nucleoside 3'-phosphoramidite and chlorophosphite reagents have been found to react with the lactam function of guanine. This reaction caused unsatisfactory results when oligodeoxyribonucleotides containing a large number of guanine bases were prepared in an automated solid phase synthesizer. The guanine modification is unstable, and leads to depurination and chain cleavage. This side reaction can be eliminated by protecting the O6-position. A new O6-p-nitrophenylethyldeoxyguanosine phosphoramidite derivative, 8, was used to prepare sequences containing up to 24 guanine bases with greatly improved results. A hexatriacontanucleotide, d(CGCGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCTCA), was also prepared using O6-protected deoxyguanosine nucleosides.     

Three dimensional typological studies using scanning electron microscopy for characterization of Termitomyces pellets obtained from submerged growth conditions

There are gaps in existing understanding of fungal pellet growth dynamics. We used scanning electron microscopy (SEM) for morphological characterization of the biomass organization of Termitomyces pellets for seven species: T. microcarpus (TMI1), T. albuminosus (TAL1, TAL2), T. striatus (TSTR), T. aurantiacus (TAUR), T. heimii (THE1, THE2), T. globulus (TGLO) and T. clypeatus (TCL1, TCL2, TCL3, TCL4, TCL5). We assessed the utility of SEM for morphological and structural characterization of Termitomyces spp. in three dimensional (3D) pellet form to identify ideal pellet morphology for industrial use. Typological classification of Termitomyces species was based on furrows, isotropy, total motifs and fractal dimensions. The pellets formed were entangled and exhibited highly compacted mycelial mass with microheterogeneity and microporosity. The mean density of furrows of Termitomyces species was between 10,000 and 11,300 cm/cm², percentage isotropy was 30?80 and total motifs varied from 300 to 2500. TGLO exhibited the highest furrow mean density, 11243 cm/cm², which indicated a compact, cerebroid structure with complex ridges and furrows, whereas TAL2 exhibited the lowest furrow density. TMI1a exhibited a high percentage isotropic value, 74.6, TSTR exhibited the lowest, 30.9. Total motif number also was used as a typological classification parameter. Fractal values were 2.64?2.78 for various submerged conditions of Termitomyces species. TAL1 exhibited the highest fractal dimension and TAL2 the lowest, which indicates the complexity of branching patterns. Three-dimensional SEM image analysis can provide insight into pellet micromorphology and is a powerful tool for exploring topographical details of pellets.     

Organelle-cytoskeletal interactions: actin mutations inhibit meiosis-dependent mitochondrial rearrangement in the budding yeast Saccharomyces cerevisiae.

During early stages of meiosis I, yeast mitochondria fuse to form a single continuous thread. Thereafter, portions of the mitochondrial thread are equally distributed to daughter cells. Using time-lapse fluorescence microscopy and a membrane potential sensing dye, mitochondria are resolved as small particles at the cell periphery in pre-meiotic, living yeast. These organelles display low levels of movement. During meiosis I, we observed a threefold increase in mitochondrial motility. Mitochondrial movements were linear, occurred at a maximum velocity of 25 +/- 6.7 nm/s, and resulted in organelle collision and fusion to form elongated tubular structures. Mitochondria do not co-localize with microtubules. Destabilization of microtubules by nocodazole treatment has no significant effect on the rate and extent of thread formation. In contrast, yeast bearing temperature-sensitive mutations in the actin-encoding ACT1 gene (act1-3 and act1-133) exhibit abnormal mitochondrial aggregation, fragmentation, and enlargement as well as loss of mitochondrial motility. In act1-3 cells, mitochondrial defects and actin delocalization occur only at restrictive temperatures. The act1-133 mutation, which perturbs the myosin-binding site of actin without significantly affecting actin cytoskeletal structure in meiotic yeast, results in mitochondrial morphology and motility defects at restrictive and permissive temperatures. These studies support a role for the actin cytoskeleton in the control of mitochondrial position and movements in meiotic yeast.     

Direct and Indirect Methods for Molar-Mass Analysis of Fragments of the Capsular Polysaccharide ofHaemophilus influenzaeType b

Two methods are described for direct molar-mass measurement of low-molar-mass fragments obtained by oxidative cleavage of the capsular polysaccharide ofHaemophilus influenzaetype b. Absolute molar masses were determined by size-exclusion chromatography (SEC) with detection by multiangle laserlight-scattering photometry (MALLS) and differential refractometry (RI). The end-group structure of the polysaccharide fragments allowed the direct measurement of average chain length by quantitative¹H NMR, from which molar masses were derived. Variation between the molar masses obtained by the two methods ranged from 5 to 7%. When molar masses estimated by indirect methods were compared to SEC-MALLS/RI data, significant deviations were observed. Analysis by SEC with secondary calibration with dextran standards gave molar masses that exceeded the SEC-MALLS/RI data by as much as 2.5-fold. Molar masses estimated by a combination of colorimetric assays varied from the SEC-MALLS/RI data by as much as 50%. These results demonstrated the applicability and superior accuracy of the direct methods of molar-mass determination of the polysaccharide fragments.     

Sea urchin Hox genes: insights into the ancestral Hox cluster

We describe the Hox cluster in the radially symmetric sea urchin and compare our findings to what is known from clusters in bilaterally symmetric animals. Several Hox genes from the direct-developing sea urchin Heliocidaris erythrogramma are described. CHEF gel analysis shows that the Hox genes are clustered on a < or = 300 kilobase (kb) fragment of DNA, and only a single cluster is present, as in lower chordates and other nonvertebrate metazoans. Phylogenetic analyses of sea urchin, amphioxus, Drosophila, and selected vertebrate Hox genes confirm that the H. erythrogramma genes, and others previously cloned from other sea urchins, belong to anterior, central, and posterior groups. Despite their radial body plan and lack of cephalization, echinoderms retain at least one of the anterior group Hox genes, an orthologue of Hox3. The structure of the echinoderm Hox cluster suggests that the ancestral deuterostome had a Hox cluster more similar to the current chordate cluster than was expected Sea urchins have at least three Abd-B type genes, suggesting that Abd-B expansion began before the radiation of deuterostomes.      

Prevention of chain cleavage in the chemical synthesis of 2''-silylated oligoribonucleotides.

Strong aqueous ammonium hydroxide used to remove N-acyl protecting groups from synthetic oligoribonucleotides causes removal of some alkylsilyl protecting groups from 2'-hydroxyls and leads to chain cleavage. This problem is most severe when 30% ammonium hydroxide is used and substantially reduced but still detectable when 3:1 ammonium hydroxide-ethanol is used. We have virtually eliminated this unwanted cleavage by incorporating the labile phenoxyacetyl amino protecting group on adenosine and guanosine. The N-benzoyl protecting group remains adequate for cytidine nucleosides. Synthetic oligoribonucleotides containing these N-acylated nucleosides and 2'-t-butyldimethylsilyl or 2'-triisopropylsilyl protecting groups can be deacylated by room temperature treatment in saturated anhydrous methanolic ammonia (8-12 h) without causing any detectable chain cleavage.