Membrane-trafficking RabA4c involved in the effect of glycine betaine on recovery from chilling stress in Arabidopsis

Glycine betaine (GB) can confer tolerance to several types of stress at low concentrations, either after application to plants or in transgenics engineered to overproduce GB. Based on earlier studies on levels of GB in plants and evidence for effects on gene expression, we hypothesized that at least part of this effect could be ascribed to the activation of the expression of stress tolerance genes. Using a strategy based on high-throughput gene expression analysis with microarrays followed by confirmation with northern blots, we identified Arabidopsis genes upregulated in roots that reinforce intracellular processes protecting cells from oxidative damage and others that appear to be involved in reinforcing a scavenging system for reactive oxygen species (ROS) in cell walls. Upregulated genes in roots include those for the membrane-trafficking RabA4c, the root-specific NADPH-dependent ferric reductase (FRO2) localized to the plasma membrane, mitochondrial catalase 2 and the cell wall peroxidase ATP3a. Comparative studies with wild-type Arabidopsis and knockout mutants for the membrane-trafficking RabA4c gene demonstrated that the mutants respond only slightly to GB, if at all, compared with wild-type in relation to root growth recovery after chilling stress, demonstrating the role of RabA4c in relation to the GB effect. The results point toward links between oxidative stress, gene expression, membrane trafficking and scavenging of ROS such as superoxide and hydrogen peroxide in relation to GB effects on chilling tolerance in plants.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Effect of dietary boron on mineral, estrogen, and testosterone metabolism in postmenopausal women

A study was done to examine the effects of aluminum, magnesium, and boron on major mineral metabolism in postmenopausal women. This communication describes some of the effects of dietary boron on 12 women between the ages of 48 and 82 housed in a metabolic unit. A boron supplement of 3 mg/day markedly affected several indices of mineral metabolism of seven women consuming a low-magnesium diet and five women consuming a diet adequate in magnesium; the women had consumed a conventional diet supplying about 0.25 mg boron/day for 119 days. Boron supplementation markedly reduced the urinary excretion of calcium and magnesium; the depression seemed more marked when dietary magnesium was low. Boron supplementation depressed the urinary excretion of phosphorus by the low-magnesium, but not by the adequate-magnesium, women. Boron supplementation markedly elevated the serum concentrations of 17 beta-estradiol and testosterone; the elevation seemed more marked when dietary magnesium was low. Neither high dietary aluminum (1000 mg/day) nor an interaction between boron and aluminum affected the variables presented. The findings suggest that supplementation of a low-boron diet with an amount of boron commonly found in diets high in fruits and vegetables induces changes in postmenopausal women consistent with the prevention of calcium loss and bone demineralization.     

Temporal relation of antigenaemia and loss of antibodies to core antigens to development of clinical disease in HIV infection.

A total of 276 sequential serum samples from 34 men with antibodies to the human immunodeficiency virus (HIV) followed up for two to seven years were analysed for HIV antigen and antibodies to the viral core and envelope proteins. Results were correlated with clinical outcome and CD4 T lymphocyte count. Both antigenaemia and the disappearance of antibodies to the core protein were associated with development of the acquired immune deficiency syndrome (AIDS) or AIDS related complex and depletion of CD4 cells. Thus AIDS or AIDS related complex developed in eight out of 16 patients with antigenaemia compared with one out of 18 patients without antigenaemia. Low counts of CD4 cells (less than 0.5 X 10(9)/l) were found in 14 of the 16 patients with antigenaemia and five of the 18 without antigenaemia. Nine patients seroconverted to HIV during the study; two of these developed antigenaemia 14 and 16 months after the estimated time of seroconversion. These results show that the late stages of HIV infection are characterised by increased production of antigen and a decrease in antibodies directed against the core protein. Antigenaemia indicates a poor prognosis; and as the antigen test is simple to do and interpret, it may therefore be useful for selecting patients for antiviral treatment.     

Effects of phorbol esters on endothelial cell microfilaments: Laser scanning confocal microscopy and quantitative morphometry of dose dependent changes

Phorbol esters are known to alter microfilaments but it is not clear if the changes correspond to modulation of the phosphoinositide turnover/protein kinase C system. The novel technique of laser scanning confocal epifluorescence was used to study fiber orientation in phorbol ester treated cells. We treated endothelial cells with control agents and agents known to stimulate protein kinase C: 4 alpha-phorbol, phorbol 12-myristate 13-acetate (PMA), phorbol dibutyrate (PDB), or lipopolysaccharide. After incubation with the test agents, the endothelial cell microfilaments were stained with rhodamine pholloidin and viewed by conventional epifluorescence and by laser scanning confocal epifluorescence microscopy. The images obtained by the confocal microscopy corresponded to a thin optical section through the cells, 300 nm or more in thickness. The microfilaments extended predominantly in the plane of focus. After exposure of the cells to phorbol esters, the stress fibers became more nearly parallel in arrangement or were shortened, but remained in the plane of focus. The modification of microfilaments in response to phorbol esters was quantitated by a single blind analysis. In order to compare the morphological changes with a biochemical action of the phorbol esters, we measured phosphoinositide turnover. The dose-dependence of morphological changes was compared and contrasted to the dose-dependent effect of phorbol esters on bradykinin-stimulated phosphoinositide turnover. PMA had about the same EC50 (1-5 nM) for both biochemical and morphological processes. PDB was less potent in inducing the disruption of microfilament structure than in inhibiting phosphoinositide turnover. Lipopolysaccharide was ineffective in inducing a morphological change under these conditions. A simple activation of protein kinase C is insufficient to explain the dose-dependent effects of phorbol esters. Thus a morphometric analysis can help distinguish the potency of cytoskeleton modulators.     

Phospholipid composition of plasma and erythrocytes in the neonate

The total phospholipids and their various classes in erythrocytes and blood plasma were determined quantitatively by means of two-dimensional thin-layer chromatography. The total amount of phospholipids in neonate plasma was approximately half of that found in adult plasma, however, the amount of phospholipids in erythrocytes of the neonate was significantly higher. The differences were observed in some classes of phospholipids in the plasma and erythrocytes of neonates as well as adult human beings.     

Regeneration of plants from hypocotyl protoplasts of rapessed (Brassica napus L. var. oleifera) cultivars

Protoplast cultures were prepared from hypocotyls of ten spring rapeseed cultivars. Protoplasts from all genotypes tested formed calli, and shoots were regenerated from calli of nine of the genotypes at frequencies varying from 15 to 76%. The regenerating cultivars fell into a high regenerating group (>60% and a low regenerating group <25%).