Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.     

Subcellular pH and predicted pH-dependent features of proteins

A characteristic of two-dimensional proteomics gels is a general bimodal distribution of isoelectric (pI) values. Discussion of this feature has focussed on the balance of acidic and basic ionisable residues, and potential relationships between pI distributions and organism classification or protein subcellular location. Electrostatics calculations on a set of protein structures with known subcellular location show that predicted folded state pI are similar to those calculated from sequence alone, but adjusted according to a general stabilising effect from interactions between ionisable groups. Bimodal distributions dominate both pI and the predicted pH of maximal stability. However, there are significant differences between these features. The average pH of maximal stability generally follows organelle pH. Average pI values are well removed from organelle pH in most subcellular environments, consistent with the view that proteins have evolved to carry (on average) net charge in a given subcellular location, and relevant to discussion of solubility in crowded environments. Correlation of the predicted pH of maximum stability with subcellular pH suggests an evolutionary pressure to adjust folded state interactions according to environment. Finally, our analysis of ionisable group contributions to stability suggests that Golgi proteins have the largest such term, although this dataset is small.     

Epidemiologic data of malignant melanoma in Osijek-Baranya County (Eastern Croatia) during the period of 2000-2008

During the past several decades there has been a substantial increase in the incidence of malignant melanoma worldwide. The highest incidences were reported in New Zealand and Australia. In Europe the northern countries generally have a higher incidence. The aim of this retrospective study was to provide the incidence and mortality for all patients with malignant melanoma diagnosed in Osijek-Baranya County, Eastern Croatia, during 2000-2008. In the past 30 years in the Republic of Croatia the incidence of melanoma increased by 337%. During the period of 2000-2006 in Osijek-Baranja County, the incidence of melanoma increased by 13%. The incidence of melanoma increases with age, but in past decades melanoma is more often diagnosed in people aged 25-40. The mortality between 2000 and 2008 increased by 18%. The incidence of melanoma generally increases equally in men and women. The most common localization of skin melanoma in males was trunk and in females the lower extremities. Presently, in Osijek-Baranya County melanoma is 15th on the list of malignant tumors and represent 2% of all malignant tumors. In New Zealand, Australia and European northern countries mortality is reduced, as result of earlier diagnosis and education of risk groups. Unfortunately, in Osijek-Baranya County, in a comparison with these countries, the mortality is higher although incidence is the same or lower.     

Cardiopulmonary effects of hemorrhagic shock in splenic autotransplanted pigs: a new surgical model

The spleen is an important organ for hemodynamic compensation during hemorrhagic shock. The aim of the study was to compare the hemodynamic and metabolic responses of sham-operated pigs with intact spleen, splenectomized pigs, and splenic autotransplanted pigs during hemorrhagic shock. Hemorrhagic shock was induced by 30% total blood volume bleed in sham-operated, splenectomized and splenic autotransplanted pigs (n = 20). Cardiopulmonary and metabolic variables were measured before, immediately after, and at 20, 60 and 100 minutes after hemorrhage. Upon hemorrhagic shock induction, body temperature, mean arterial pressure, mean pulmonary arterial pressure, cardiac output, cardiac index and oxygen delivery decreased, while lactate and shock index increased. Hemoglobin and hematocrit were significantly lower in the splenectomized and splenic autotransplant groups as compared with the control group at 60 and 100 minutes after hemorrhage (p < 0.05). Unlike intact spleen, splenic autotransplant could not improve hemodynamic parameters in hemorrhagic shock in pigs. In comparison to mice, rats or dogs, this species could be an interesting investigation model to test new surgical procedures during splenic related hemorrhagic shock, with potential applications in human medicine.     

The immunomodulation effect of allogenic blood transfusion in colorectal cancer--a new approach

The total number of 542 patients with colorectal cancer surgery have been analyzed in order to estimate the effect of receiving transfusion local recurrences, and the disease free - survival. It should be examined whether there are changes in general immunity indicators which would be connected with perioperative transfusion. A significant connection has been found between local recurrences and blood transfusion (p<0.0001), the most noticeable being in Dukes A (p =0.045), localization on rectum (p=0.036). The receiving of blood transfusion is linked significantly with disease free - survival reduction (p =0.0068; log rank), the most significant being in Dukes A stage (p =0.0123; log rank) and with localization on rectum (p=0.0231). The analysis of general immunity indicators has shown significant immunocompromitation of patients just before the surgery and this could have effect on immunomodulation caused by transfusion and just as on the treatment prognosis of colorectal carcinoma.     

Incidence of pituitary tumors in the human population of Croatia

Pituitary tumors are rare tumors (less then 10%) of the central nervous system (CNS), which malignicity depends on their localization, meanwhile, their biological nature is benign. The diameter they have is mostly less then 10 mm (microadenomas), but sometimes could be 10 mm (macroadenomas) to 5 cm and more and then are usually nonfunctional (about 20% of all pituitary tumors). Clinical presence depends on their localisation and hormonal activity. In the Center for Clinical Neuroendocrinology and Pituitary Diseases, in the last working 10 years, there were treated and examined 504 patients from Croatia, all with pituitary tumors: 182 patients with prolactinomas, 137 with acromegaly, 70 with Morbus Cushing (Mb. Cushing), and 115 patients with nonfunctional pituitary tumors. The patient's classification is based on regional (Mediterranean and continental region, 20 counties) and the state level. In our analysis we haven't found difference in incidence of tumors between Mediterranean and continental region.     

Variations in mugwort (Artemisia spp.) airborne pollen concentrations at three sites in central Croatia, in period from 2002 to 2003

In spite of the low atmospheric pollen levels, Artemisia sensitisation and allergy has been reported widely. The aim of the study was to determine the length of pollen season, intradiurnal, daily and monthly pollen variation, and the effect of some meteorological parameters on atmospheric pollen concentrations in Central Croatia. Seven-day Hirst volumetric pollen and spore traps were used for pollen sampling. The Artemisia pollen season lasted from the end of July until the end of September with the highest concentrations in August. The percentage of the total pollen count ranged from 0.52% to 0.92%. The intradiurnal peak occurred between 10 a.m. and 12 a.m. Statistical analysis showed a significant correlations between higher air temperature and high pollen concentration as well as high precipitation and low pollen concentration. Results of this study are expected to help in preventing the symptoms of allergic reaction in individuals with Artemisia pollen hypersensitivity.     

Multiscale design and multiobjective optimization of orthopedic hip implants with functionally graded cellular material

Revision surgeries of total hip arthroplasty are often caused by a deficient structural compatibility of the implant. Two main culprits, among others, are bone-implant interface instability and bone resorption. To address these issues, in this paper we propose a novel type of implant, which, in contrast to current hip replacement implants made of either a fully solid or a foam material, consists of a lattice microstructure with nonhomogeneous distribution of material properties. A methodology based on multiscale mechanics and design optimization is introduced to synthesize a graded cellular implant that can minimize concurrently bone resorption and implant interface failure. The procedure is applied to the design of a 2D left implanted femur with optimized gradients of relative density. To assess the manufacturability of the graded cellular microstructure, a proof-of-concept is fabricated by using rapid prototyping. The results from the analysis are used to compare the optimized cellular implant with a fully dense titanium implant and a homogeneous foam implant with a relative density of 50%. The bone resorption and the maximum value of interface stress of the cellular implant are found to be over 70% and 50% less than the titanium implant while being 53% and 65% less than the foam implant.     

Hormone-induced 14-3-3γ adaptor protein regulates steroidogenic acute regulatory protein activity and steroid biosynthesis in MA-10 Leydig cells

Cholesterol is the sole precursor of steroid hormones in the body. The import of cholesterol to the inner mitochondrial membrane, the rate-limiting step in steroid biosynthesis, relies on the formation of a protein complex that assembles at the outer mitochondrial membrane called the transduceosome. The transduceosome contains several mitochondrial and cytosolic components, including the steroidogenic acute regulatory protein (STAR). Human chorionic gonadotropin (hCG) induces de novo synthesis of STAR, a process shown to parallel maximal steroid production. In the hCG-dependent steroidogenic MA-10 mouse Leydig cell line, the 14-3-3γ protein was identified in native mitochondrial complexes by mass spectrometry and immunoblotting, and its levels increased in response to hCG treatment. The 14-3-3 proteins bind and regulate the activity of many proteins, acting via target protein activation, modification and localization. In MA-10 cells, cAMP induces 14-3-3γ expression parallel to STAR expression. Silencing of 14-3-3γ expression potentiates hormone-induced steroidogenesis. Binding motifs of 14-3-3γ were identified in components of the transduceosome, including STAR. Immunoprecipitation studies demonstrate a hormone-dependent interaction between 14-3-3γ and STAR that coincides with reduced 14-3-3γ homodimerization. The binding site of 14-3-3γ on STAR was identified to be Ser-194 in the STAR-related sterol binding lipid transfer (START) domain, the site phosphorylated in response to hCG. Taken together, these results demonstrate that 14-3-3γ negatively regulates steroidogenesis by binding to Ser-194 of STAR, thus keeping STAR in an unfolded state, unable to induce maximal steroidogenesis. Over time 14-3-3γ homodimerizes and dissociates from STAR, allowing this protein to induce maximal mitochondrial steroid formation.     

Specific Biomarkers Are Associated with Docetaxeland Gemcitabine-Resistant NSCLC Cell Lines

Five-year survival rate for lung cancer is limited to 10% to 15%. Therefore, the identification of novel therapeutic prognostic factors is an urgent requirement. The aim of this study is thus to highlight specific biomarkers in chemoresistant non-small cell lung cancer cell lines. Therefore, we checked—in the control condition as well as after short-term pharmacological treatment with either docetaxel or gemcitabine—the expression of genes such as tumor suppressor genes (CDKN2A, DAPK, FHIT, GSTP1, MGMT, RARβ2, RASSF1A, and TIMP3), genes associated with drug resistance (BRCA1, COX2, ERCC1, IGFBP3, RRM1, and TUBB3), and stemness-related genes (CD133, OCT4, and SLUG) in two cellular models of squamous carcinoma (CAEP) and adenocarcinoma (RAL) of the lung originally established. Their promoter methylation profile was also evaluated. Drug-related genes were upregulated. Cisplatin resistance matched with high levels of BRCA1 and ERCC1 in both cell lines; docetaxel sensitivity of CAEP cells was associated to levels of TUBB3 lower than RAL cells. Although CAEP cells were more sensitive to gemcitabine, both cell lines showed high levels of RRM1. Stemness-related genes were downregulated in the control condition but became upregulated in docetaxel-resistant cells, indicating the selection of a population with stemness features. We did not find an unequivocal correspondence between gene expression and respective DNA promoter methylation status, suggesting the involvement of additional mechanisms of gene expression regulation. These results highlight specific biomarkers consistent with the different responses of the two cell lines to standard pharmacological treatments and indicate specific molecular traits for their chemoresistance.