Metabolism of leukotriene B4 by guinea pig eosinophils

The metabolism of leukotriene B₄ (5(S),12(R)-dihydroxy-6-cis-8,10-trans-14-cis-eicosatetraenoic acid) by isolated guinea pig eosinophils was investigated. Incubation of guinea pig eosinophils with [³H]-leukotriene B₄ resulted in the rapid conversion of leukotriene B₄ to several more polar metabolites. Two of these metabolites were identified by ultraviolet spectroscopy and gas chromatography-mass spectrometry as the omega oxidation products 5(S),12(R),20-trihydroxy-6,8,10,14-eicosatetraenoic acid (20-hydroxy-leukotriene B₄) and 5(S),12(R),19-trihydroxy-6,8,10,14-eicosatetraenoic acid (19-hydroxy-leukotriene B₄). Two novel metabolites, 5(S),12(R),18,19-tetrahydroxy-6,8,10,14 eicosatetraenoic acid (18,19-dihydroxy-leukotriene B₄) and 5(S),12(R)-dihydroxy-1,18-dicarboxylic-6,8,10,14,16-octadecapentaenoic acid (Δ16,17–18-carboxy-19,20-dinor-leukotriene B₄) were tentatively identified. The identification of these compounds indicates that guinea pig eosinophils are capable of metabolizing leukotriene B₄ by both omega and beta oxidation. This catabolic activity may play a role in modulating inflammatory reactions by removing the chemoattractant leukotriene B₄ from inflammatory sites.     

Performance of a new family of modular,bed-supported,chromatography devices

Prepacked chromatography columns and cassette filtration units offer many advantages in bioprocessing. These include reduced labor costs and processing times, ease of storage, and enhanced process flexibility. Rectangular formats are particularly attractive as they can be easily stacked and multiplexed together for continuous processing. Cylindrical chromatography beds have dominated bioprocessing even though their bed support and pressure-flow performance vary with bed dimensions. This work presents the performance of novel, rhombohedral chromatography devices with internally supported beds. They are compatible with existing chromatography workstations and can be packed with any standard commercial resin. The devices offer pressure-flow characteristics independent of container-volume, simple multiplexing, and separation performance comparable to cylindrical columns. Their bi-planar, internal bed support allows mechanically less-rigid resins to be used at up to four times higher maximal linear velocities, and productivities approaching 200 g/L/h for affinity resins, compared to the 20 g/L/h typical of many column-based devices. Three 5 L devices should allow processing of up to 3 kg of monoclonal antibody per hour.     

Chemical Composition and Insecticidal Activity against Tribolium Castaneum of Thapsia garganica L. Seed Essential Oil

Due to the several side effects of synthetic pesticides, including environmental pollution, threats to human health, and the development of pest resistance to insecticides, the use of alternative healthy, available and efficient agents in pest management strategies is necessary. Recently, the use of essential oil obtained from aromatic plants has shown significant potential for insect pest management. For this reason, the essential oil isolated from seeds of Thapsia garganica L. was investigated for the first time for its chemical profile, and its toxicity and repellency effects against Tribolium castaneum adults. Qualitative and quantitative analyses of the chemical composition by gas chromatography coupled to mass spectrometry (GC/MS) revealed the presence of 18 organic volatiles representing 96.8 % of the total constituents. The main compounds were 1,4-dimethylazulene (51.3 %) followed by methyl palmitate (8.2 %), methyl linoleate (6.2 %) and costol (5.1 %). Concerning the repellent effect, results revealed that SEO (Seed Essential Oil) was very repellent towards T. castaneum adults, with 100 % repellency after 2 h of exposure. Furthermore, the essential oil exhibited remarkable contact toxicity against T. castaneum (93.3 % of mortality) at the concentration of 10 % (v/v). The median lethal dose (LD₅₀) of the topical application of the seed essential oil was 4.4 %. These encouraging outcomes suggested that the essential oil from T. garganica seeds could be considered a potent natural alternative to residual persistent and toxic insecticides.     

Treatment of Helicobacter pylori Infection: A Review of the World Literature

Background. None of the currently used anti- Helicobacter pylori drug regimens cures the infection 100%, and cure results still vary considerably. The present article reviews the effectiveness of currently used antimicrobial regimens, aimed to cure H. pylori infection.
Methods. Data collection started from the beginning of the anti- H. pylori -therapy era until May 1995. No attempt at formal metanalysis has been made, because many studies have been published only in abstract form. Attempts were made to exclude duplicates of studies by comparison to previously reported ones; the authors of suspected duplicates were contacted. After amalgamation of the number of included patients and the number of successfully treated patients, the mean values of eradication rates and the 95% confidence intervals were calculated.
Results. A total of 237 treatment arms were analyzed. Bismuth triple therapy continues to reach high eradication rates worldwide (78–89%). Side effects leading to diminished patient compliance and the marked decline of eradication efficacy in cases of metronidazole resistance are considered to be the major drawbacks of this therapy. Proton pump inhibitor (PPI) dual therapy is better tolerated with fewer side effects than is bismuth triple therapy. The mean eradication rates vary from 55 to 75%, and the extremes lie between 24 and 93%. PPI triple therapies have been shown to be very effective against H. pylori (eradication rates, 80–89%). Quadruple therapy leads to a mean eradication rate of 96%.
Conclusion. Based on efficacy, PPI triple or bismuth triple therapy are recommended as first-line treatment for H. pylori infection. Quadruple therapy could serve as second-line treatment for eradication of initial failures and in case of metronidazole resistance.     

Enhanced quantitative resistance against fungal disease by combinatorial expression of different barley antifungal proteins in transgenic tobacco

cDNAs encoding three proteins from barley ( Hordeum vulgare ), a class-II chitinase (CHI), a class-II β-1,3-glucanase (GLU) and a Type-I ribosome-inactivating protein (RIP) were expressed in tobacco plants under the control of the CaMV 35S-promoter. High-level expression of the transferred genes was detected in the transgenic plants by Northern and Western blot analysis. The leader peptides in CHI and GLU led to accumulation of these proteins in the intercellular space of tobacco leaves. RIP, which is naturally deposited in the cytosol of barley endosperm cells, was expressed either in its original cytosolic form or fused to a plant secretion peptide (spRIP). Fungal infection assays revealed that expression of the individual genes in each case resulted in an increased protection against the soilborne fungal pathogen Rhizoctonia solani , which infects a range of plant species including tobacco. To create a situation similar to 'multi-gene' tolerance, which traditional breeding experience has shown to provide crops with a longer-lasting protection, several of these antifungal genes were combined and protection against fungal attack resulting from their co-expression in planta was evaluated. Transgenic tobacco lines were generated with tandemly arranged genes coding for RIP and CHI as well as GLU and CHI. The performance of tobacco plants co-expressing the barley transgenes GLU/ CHI or CHI/RIP in a Rhizoctonia solani infection assay revealed significantly enhanced protection against fungal attack when compared with the protection levels obtained with corresponding isogenic lines expressing a single barley transgene to a similar level. The data indicate synergistic protective interaction of the co-expressed anti-fungal proteins in vivo .     

Chemie und Systematik in der FlechtengattungRhizocarpon: Hochdruckflüssigkeitschromatographie (HPLC) der Flechten-Sekundärstoffe derRhizocarpon superficiale-Gruppe

The secondary lichen products of 31 specimens of theRhizocarpon superficiale group are examined by high performance liquid chromatography (HPLC). At 260 nm 13 different compounds have been detected. 6 of them are well-known lichen acids which occur in nearly all the species; but proportions are different and constant for each species. An analytical key is added.

Beitrag I einer Publikationsreihe.     

Cytochrome P-450 and glutathione: what is the significance of their interrelationship in lipid peroxidation?

Both cytochrome P-450 and glutathione participate in the metabolism of xenobiotics. Their interrelationship is described here, as well as current findings indicating their mutual involvement in lipid peroxidation.     

Amino acid transport in the rat exocrine pancreas

Summary Amino acid transport and incorporation have been studied in vitro in rat pancreatic lobules after maximal and supramaximal hormonal stimulation with caerulein. Incorporation into proteins was increased already after 30 and 120 min of maximal stimulation, but was decreased after the infusion of a supramaximal dose. Uptake of neutral amino acids was monitored using labeled leucine and -aminoisobutyric acid (AIB). In the case of leucine the free pool was consistently reduced after maximal stimulation, while supramaximal doses led to an increase which could be potentiated by the addition of 2mM tetracaine. Using AIB, a significant increase in the intracellular pool was observed after maximal stimulation, conversely a decrease after supramaximal stimulation. Release of labeled leucine and AIB from preloaded lobules during incubation in the cold was significantly reduced after maximal secretory stimulation, but was found enhanced by 200 to 300 percent after supramaximal stimulation. No fine structural alterations at junctional complexes or at both the lateral and luminal plasma membranes were observed after maximal stimulation except an increased number of exocytotic figures at the luminal face. However, supramaximal stimulation led to progressive rarefaction of the tight junctional network and disintegration of the gap junctions. Concomitantly, an equal distribution of membrane particles on both faces of the plasma membrane together with a random occurrence of exocytotic figures were observed.Supported by a grant from the Deutsche Forschungsgemeinschaft, Bonn-Bad Godesberg (SFB 122, project C 5). Dedicated to Professor Dr. Gerhard Petry, Marburg, on the occasion of his 65th birthday     

Effect of temperature on the stability and activity of crystalline ox liver nuclear and mitochondrial glutamate dehydrogenases

A study on the response of the stability and activity of crystalline ox liver nuclear and mitochondrial glutamate dehydrogenases to temperature variations has been carried out. The thermodynamic properties of the heat inactivation process and of the reaction with the substrates glutamate and α-ketoglutarate have been investigated. The heat inactivation of nuclear glutamate dehydrogenase proceeds at a faster rate than that of the mitochondrial enzyme in the temperature range 40–51 °C; the enthalpy of activation of the inactivation process is higher and the entropy is almost double, compared to the values of mitochondrial glutamate dehydrogenase. The effect of temperature on the maximal velocity shows that, with both glutamate and α-ketoglutarate, the enthalpy of activation with nuclear glutamate dehydrogenase is double and the decrease in entropy almost half of the values of the mitochondrial enzyme. The variation of the apparent K_m with temperature shows a decrease of the affinity of both enzymes for glutamate, with no major difference in the thermodynamic properties of the reaction. With α-ketoglutarate, on the other hand, the affinity of nuclear glutamate dehydrogenase decreased, whereas that of the mitochondrial enzyme increased with temperature. The process is therefore exothermic with the former enzyme, endothermic with the latter; furthermore, it occurs with a decrease in enthropy with nuclear glutamate dehydrogenase, but with a large increase with the mitochondrial enzyme. The studies on the effect of temperature on the activity were carried out in the range 20–44 °C.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.