Changes in endogenous indole-3-acetic acid and some biochemical parameters during seed development in <Emphasis Type="Italic">Camellia sinensis</Emphasis> (L.) O. Kuntze

The role of endogenous indole-3-acetic acid (IAA), soluble proteins and RNA in the development of tea (Camellia sinensis (L). O. Kuntze) seeds was investigated in the present study. The state of continuum even at full maturity and lack of a clear end point to seed development as indicated by the persistence of appreciable contents of proteins at full maturity in all the seed parts further confirmed the ‘recalcitrant nature’ of the tea seeds. Unlike the orthodox seeds, the level of free IAA in tea embryos also remained high even at full maturity. The total RNA content remained high in the stages with high moisture content but declined with progressive decline in moisture content.     

Endogenous ocular lipids as potential modulators of intraocular pressure

Elevated intraocular pressure (IOP) is a risk factor in glaucoma, a group of irreversible blinding diseases. Endogenous lipids may be involved in regulation of IOP homeostasis. We present comparative fold analysis of phospholipids and sphingolipids of aqueous humour and trabecular meshwork from human control vs primary open-angle glaucoma and mouse control (normotensive) vs ocular hypertensive state. The fold analysis in control vs disease state was based on ratiometric mass spectrometric data for above classes of lipids. We standardized in vitro assays for rapid characterization of lipids undergoing significant diminishment in disease state. Evaluation of lipids using in vitro assays helped select a finite number of lipids that may potentially expand cellular interstitial space embedded in an artificial matrix or increase fluid flow across a layer of cells. These assays reduced a number of lipids for initial evaluation using a mouse model, DBA/2J with spontaneous IOP elevation. These lipids were then used in other mouse models for confirmation of IOP lowering potential of a few lipids that were found promising in previous assessments. Our results provide selected lipid molecules that can be pursued for further evaluation and studies that may provide insight into their function.     

Bacopasaponins with cytotoxic activity against human breast cancer cells in vitro

Molecular Biology Reports - Globally, breast cancer is a serious concern that exhibits a persistent rise in its incidence and related mortality even after significant advancement in the field of...     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

Targeting RET to induce medullary thyroid cancer cell apoptosis: an antagonistic interplay between PI3K/Akt and p38MAPK/caspase-8 pathways

Mutations in REarranged during Transfection (RET) receptor tyrosine, followed by the oncogenic activation of RET kinase is responsible for the development of medullary thyroid carcinoma (MTC) that responds poorly to conventional chemotherapy. Targeting RET, therefore, might be useful in tailoring surveillance of MTC patients. Here we showed that theaflavins, the bioactive components of black tea, successfully induced apoptosis in human MTC cell line, TT, by inversely modulating two molecular pathways: (i) stalling PI3K/Akt/Bad pathway that resulted in mitochondrial transmembrane potential (MTP) loss, cytochrome-c release and activation of the executioner caspases-9 and -3, and (ii) upholding p38MAPK/caspase-8/caspase-3 pathway via inhibition of Ras/Raf/ERK. Over-expression of either constitutively active myristoylated-Akt-cDNA (Myr-Akt-cDNA) or dominant-negative-caspase-8-cDNA (Dn-caspase-8-cDNA) partially blocked theaflavin-induced apoptosis, while co-transfection of Myr-Akt-cDNA and Dn-caspase-8-cDNA completely eradicated the effect of theaflavins thereby negating the possibility of existence of other pathways. A search for the upstream signaling revealed that theaflavin-induced disruption of lipid raft caused interference in anchorage of RET in lipid raft that in turn stalled phosphorylation of Ras and PI3Kinase. In such anti-survival cellular micro-environment, pro-apoptotic signals were triggered to culminate into programmed death of MTC cell. These findings not only unveil a hitherto unexplained mechanism underlying theaflavin-induced MTC death, but also validate RET as a promising and potential target for MTC therapy.     

miRNA Biogenesis Enzyme Drosha Is Required for Vascular Smooth Muscle Cell Survival

miRNA biogenesis enzyme Drosha cleaves double-stranded primary miRNA by interacting with double-stranded RNA binding protein DGCR8 and processes primary miRNA into precursor miRNA to participate in the miRNA biogenesis pathway. The role of Drosha in vascular smooth muscle cells (VSMCs) has not been well addressed. We generated Drosha conditional knockout (cKO) mice by crossing VSMC-specific Cre mice, SM22-Cre, with Drosha ^loxp/loxp mice. Disruption of Drosha in VSMCs resulted in embryonic lethality at E14.5 with severe liver hemorrhage in mutant embryos. No obvious developmental delay was observed in Drosha cKO embryos. The vascular structure was absent in the yolk sac of Drosha homozygotes at E14.5. Loss of Drosha reduced VSMC proliferation in vitro and in vivo. The VSMC differentiation marker genes, including αSMA, SM22, and CNN1, and endothelial cell marker CD31 were significantly downregulated in Drosha cKO mice compared to controls. ERK1/2 mitogen-activated protein kinase and the phosphatidylinositol 3-kinase/AKT were attenuated in VSMCs in vitro and in vivo. Disruption of Drosha in VSMCs of mice leads to the dysregulation of miRNA expression. Using bioinformatics approach, the interactions between dysregulated miRNAs and their target genes were analyzed. Our data demonstrated that Drosha is required for VSMC survival by targeting multiple signaling pathways.     

Differential Response of Chondrocytes and Chondrogenic-Induced Mesenchymal Stem Cells to C1-OH Tributanoylated N-Acetylhexosamines

Articular cartilage has a limited ability to self-repair because of its avascular nature and the low mitotic activity of the residing chondrocytes. There remains a significant need to develop therapeutic strategies to increase the regenerative capacity of cells that could repair cartilage. Multiple cell types, including chondrocytes and mesenchymal stem cells, have roles in articular cartilage regeneration. In this study, we evaluated a platform technology of multiple functionalized hexosamines, namely 3,4,6-O-tributanoylated-N-acetylgalactosamine (3,4,6-O-Bu₃GalNAc), 3,4,6-O-tributanoylated-N-acetylmannosamine (3,4,6-O-Bu₃ManNAc) and 3,4,6-O-Bu₃GlcNAc, with the potential ability to reduce NFκB activity. Exposure of IL-1β-stimulated chondrocytes to the hexosamine analogs resulted in increased expression of ECM molecules and a corresponding improvement in cartilage-specific ECM accumulation. The greatest ECM accumulation was observed with 3,4,6-O-Bu₃GalNAc. In contrast, mesenchymal stem cells (MSCs) exposed to 3,4,6-O-Bu₃GalNAc exhibited a dose dependent decrease in chondrogenic differentation as indicated by decreased ECM accumulation. These studies established the disease modification potential of a hexosamine analog platform on IL-1β-stimulated chondrocytes. We determined that the modified hexosamine with the greatest potential for disease modification is 3,4,6-O-Bu₃GalNAc. This effect was distinctly different with 3,4,6-O-Bu₃GalNAc exposure to chondrogenic-induced MSCs, where a decrease in ECM accumulation and differentiation was observed. Furthermore, these studies suggest that NFκB pathway plays a complex role cartilage repair.