Effect of anti-regucalcin antibody on neutral phosphatase activity in rat liver cytosol: Involvement of endogenous regucalcin

The effect of anti-regucalcin monoclonal antibody on neutral phoshatase activity in rat liver cytosol was investigated. Phosphotyrosine, phosphoserine, and phosphothreonine were used as the substrate toward phosphatase asssy. Liver cytosolic phosphatase activity with three phosphoaminoacids was significantly increased in the presence of anti-regucalcin antibody (100 and 200 ng/ml) in the enzyme reaction mixture with calcium chloride (0.1 mM) or EGTA (1.0 mM). The effect of anti-regucalcin antibody was completely abolished in the presence of exogenous regucalcin (1.0 M), indicating the involvement of endogenous regucalcin. The anti-regucalcin anti body- increased phosphatase activity was not significantly altered in the presence of trifluoperazine (20 M), an antagonist of calmodulin, or akadaic acid (10 M), an inhibitor of protein phosphatase, although these inihibitors caused a slight decrease in liver cytosolic phosphatase activity. The effect of endogenous regucalcin might be not related to calmodulin, and it was insensitive to okadaic acid. The present findings suggest that endogenous regucalcin is involved in the regulation of protein phasphatase in rat liver cytoplasm.     

Degradation of estrogens by Rhodococcus zopfii and Rhodococcus equi isolates from activated sludge in wastewater treatment plants

We have isolated four strains of Rhodococcus which specifically degrade estrogens by using enrichment culture of activated sludge from wastewater treatment plants. Strain Y 50158, identified as Rhodococcus zopfii, completely and rapidly degraded 100 mg of 17beta-estradiol, estrone, estriol, and ethinyl estradiol/liter, as demonstrated by thin-layer chromatography and gas chromatography-mass spectrometry analyses. Strains Y 50155, Y 50156, and Y 50157, identified as Rhodococcus equi, showed degradation activities comparable with that of Y 50158. Using the random amplified polymorphism DNA fingerprinting test, these three strains were confirmed to have been derived from different sources. R. zopfii Y 50158, which showed the highest activity among these four strains, revealed that the strain selectively degraded 17beta-estradiol during jar fermentation, even when glucose was used as a readily utilizable carbon source in the culture medium. Measurement of estrogenic activities with human breast cancer-derived MVLN cells showed that these four strains each degraded 100 mg of 17beta-estradiol/liter to 1/100 of the specific activity level after 24 h. It is thus suggested that these strains degrade 17beta-estradiol into substances without estrogenic activity.     

Age-related changes of elements and relationships among elements in the common bile and pancreatic ducts

To elucidate compositional changes of the common bile and main pancreatic ducts with aging, the authors investigated age-related changes of element contents in the common bile and pancreatic ducts by inductively coupled plasma-atomic emission spectrometry. After ordinary dissection by medical students was finished, the common bile ducts and main pancreatic ducts (pancreatic ducts) were resected and the element contents were determined. The Mg content increased significantly only in the pancreatic duct with aging, but the other element contents did not change significantly in both the common bile and pancreatic ducts with aging. Regarding the relationship among the elements, significant direct correlations were found among the contents of Ca, P, S, and Mg in the common bile ducts, with some exceptions between P and either S or Mg contents. In the pancreatic ducts, significant direct correlations were found between S and Mg contents and between P and Na contents. The relationships in the elements between the common bile and pancreatic ducts were examined. It was found that there were significant direct correlations in the Ca, Mg, and Fe contents between the common bile and pancreatic ducts; that is, as Ca, Mg, and Fe increased in the common bile duct, they increased simultaneously in the pancreatic duct.     

The fertilising ability of spermatogenic cells derived from cultured mouse immature testicular tissue

There are many reports about the in vitro culture of spermatogenic cells, but no-one has succeeded in inducing the differentiation from spermatogonia to intact sperm. Also the study of in vitro testicular tissue culture has hardly advanced. We studied the culture of mouse immature testicular tissue derived from 5-day-old mice. We aimed to achieve the differentiation of spermatogenic cells in order to observe spermatogenesis in testicular tissue in vitro. We also froze mature testicular tissue and immature testicular tissue cultured for 2 weeks. Furthermore, spermatogenic cells differentiated by culturing were injected into metaphase II oocytes to determine whether these differentiated cells and frozen-thawed testicular tissue have fertilising and developmental ability. Under the culture conditions employed, secondary spermatocytes and a few round spermatids differentiated from spermatogonia were observed in the immature testicular tissue cultured for 2 weeks. When spermatogenic cells derived from cultured immature testicular tissue, cultured frozen immature testicular tissue and frozen-thawed mature testicular tissue were injected into ooplasm, the oocytes were fertilised and fertilised oocytes developed to the 8-cell stage. We suggest that spermatogenic cells derived from cultured immature testicular tissue have fertilising and developmental abilities equivalent to that of sperm. Also these abilities of spermatogenic cells obtained from cultured frozen immature testicular tissue and frozen-thawed mature testicular tissue were better than those of the same cells before freezing.     

Preferential detection of pro-carboxypeptidase R by enzyme-linked immunosorbent assay

We generated two monoclonal antibodies (mAbs), 2A16 and 10G1, against pro-carboxypeptidase R (proCPR), also known as thrombin activatable fibrinolysis inhibitor (TAFI). By use of these mAbs, we developed a sandwich enzyme-linked immunosorbent assay (ELISA) system to detect proCPR. Since the amount of the antigen detectable by the ELISA was essentially the same in fresh plasma and serum incubated at 37 C for 1 hr, we concluded that the ELISA system detected not only proCPR, but also inactivated CPR generated from proCPR. However, an appreciable amount of proCPR remained unactivated in serum. For extensive activation of proCPR in plasma, thrombin and thrombomodulin complexes (TTM) can be used together with CaCl2. Following extensive conversion of proCPR to CPR by T-TM and CaCl2, converting plasma to serum (T-TM serum), antigenicity became undetectable by ELISA. Further analysis revealed that 2A16 reacts only with proCPR although 10G1 reacts with proCPR, active CPR and inactivated CPR. Therefore, we concluded that the ELISA system preferentially detects proCPR and not CPR. Our sandwich ELISA system utilizing 2A16 and 10G1 provides a suitable method for detecting proCPR and can be used to determine levels of proCPR in plasma samples from patients.     

Polymorphism, Heteroplasmy, Mitochondrial Fusion and Diabetes

Mitochondrial DNA (mtDNA) is highly susceptible to mutations that result in polymorphisms and diseases including diabetes. We analyzed heteroplasmy, polymorphisms related to diabetes, and complementation by fusogenic proteins. Cytoplast fusion and microinjection allow, defects in mutated mtDNA inside a heteroplasmic cell to be complemented by fusing two mitochondria via human fusogenic proteins. We characterized three hfzos as well as two OPAls that prevent apoptosis. Two coiled coil domains and GTPase domains in these fusogenic proteins regulate membrane fusion. The hfzo genes were expressed mainly in the brain and in muscle that are postmitotic, but not in the pancreas. Under the influence of polymorphisms of mtDNA and nDNA, the vicious circle of reactive oxygen species and mutations in cell can be alleviated by mitochondrial fusion.     

Complete genome sequence and comparative analysis of the industrial microorganism Streptomyces avermitilis

Species of the genus Streptomyces are of major pharmaceutical interest because they synthesize a variety of bioactive secondary metabolites. We have determined the complete nucleotide sequence of the linear chromosome of Streptomyces avermitilis. S. avermitilis produces avermectins, a group of antiparasitic agents used in human and veterinary medicine. The genome contains 9,025,608 bases (average GC content, 70.7%) and encodes at least 7,574 potential open reading frames (ORFs). Thirty-five percent of the ORFs (2,664) constitute 721 paralogous families. Thirty gene clusters related to secondary metabolite biosynthesis were identified, corresponding to 6.6% of the genome. Comparison with Streptomyces coelicolor A3(2) revealed that an internal 6.5-Mb region in the S. avermitilis genome was highly conserved with respect to gene order and content, and contained all known essential genes but showed perfectly asymmetric structure at the oriC center. In contrast, the terminal regions were not conserved and preferentially contained nonessential genes.     

Novel cAMP regulatory elements in the promoter region of bovine P-450(11 beta) gene

In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)