A sensitive high performance liquid chromatographic method for determining small amounts of glycosylproteins

We developed a simple isocratic high performance liquid chromatography (HPLC) method for the quantitative determination of 5-hydroxymethyl-2-furfuraldehyde (5-HMF) liberated by mild hydrolysis of small amounts of glycosyl proteins. The absorbance of hydrolysate components after HPLC separation was recorded at 280 nm. To detect substances possibly interfering with the 5-HMF peak we always recorded the ratio of the peak heights A280 nm/A254 nm which was a constant value of 4.4. For each sample the blank was obtained by reduction with NaBH4 before hydrolysis with oxalic acid 1 mol/l. The best NaBH4/protein ratio was found to be 4 mg/mg. With this method we measured the nonenzymatic glycosylation (glycation) as 5-HMF in samples with a protein concentration as low as 0.8 mg/ml. 5-HMF produced per milligram of protein was independent from protein concentration for a wide range (0.8-10 mg/ml). The mean coefficient of variation for within assay and between precision was 6.8 and 11.6%, respectively. The 5-HMF measured on plasma proteins from normal subjects (n = 7) was 0.16 +/- 0.04 nmol/mg. Protein from insulin-dependent diabetic patients was 0.31 +/- 0.07 nmol/mg. With this method we succeeded in detecting an excessive glycation of platelet membrane proteins in 13 type-I diabetic patients.     

Inhibition of human natural killer activity by monolayers of primary cell cultures

Some primary and continuous cell cultures were tested for their capacity to regulate human natural killer (NK) activity. Primary cultures of endothelial cells, fetal fibroblasts, adult fibroblasts, amnion epithelial cells, renal parenchymal cells, and ovarian carcinoma cells inhibited NK activity when peripheral blood lymphocytes were preincubated on target cell monolayers for 18 h before testing the cytotoxicity against K-562. The supernatants of the inhibiting cell cultures were not suppressive. Prostaglandins or suppressive lymphocytes were not involved in the phenomenon. The binding capacity of the effector cells was not changed, suggesting that the suppressive signal was targeted at the cytolytic machinery of NK cells. The down-regulating capacity of the cell cultures weakened significantly during subculturing in vitro, and continuous cell lines were not inhibitory. The inactivation of NK cells may be one of the mechanisms by which target cells are protected from NK activity.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

The crystal structure of the beta-lactamase of Streptomyces albus G at 0.3 nm resolution.

The crystal structure of the beta-lactamase of Streptomyces albus G has been solved at 0.3 nm resolution by X-ray-diffraction methods. The enzyme is a typical two-domain protein. One domain consists of five alpha-helices, and the other is five-stranded beta-sheet with alpha-helices on both sides of the sheet. The active-site serine residue (Ser-48) is within a cleft located between the two domains.     

Hydrogen peroxide production in uncoupled mitochondria of the parasitic nematode worm Nippostrongylus brasiliensis.

1. Mitochondria from the parasitic nematode worm Nippostrongylus brasiliensis produce H2O2 in the energized state; higher rates of H2O2 production were observed in the presence of the uncoupler carbonyl cyanide m-chlorophenylhydrazone. 2. Antimycin A inhibits respiration and H2O2 production by 70 and 65% respectively; the residual activities can be attributed to alternative electron-transport pathway(s). 3. o-Hydroxydiphenyl and 1,3,5-trihydroxybenzene, inhibitors of alternative electron transport, inhibit respiration by 37% and H2O2 production by 26%. 4. Another inhibitor of alternative electron transport, salicylhydroxamic acid, shows a complex mode of action; low concentrations (less than 0.5 mM) stimulate respiration and H2O2 production, whereas 2 mM-salicylhydroxamic acid inhibited respiration by 35% and stopped H2O2 production completely. 5. O2 thresholds were observed for the inhibition of respiration at O2 concentrations greater than 57.7 microM and inhibition of H2O2 production (greater than 20.5 microM-O2); apparent Km values for oxygen were 5.5 microM and 3.0 microM respectively. 6. In the presence of antimycin A the O2-inhibition thresholds and apparent Km values for O2 of respiration and H2O2 production matched closely, suggesting that the alternative oxidase is a likely site of H2O2 production. 7. These results are discussed in relation to O2 toxicity to N. brasiliensis.     

Influence of the gut microflora on protein synthesis in tissues and in the whole body of chicks.

1. The influence of the gut microflora on protein synthesis in individual tissues and in the whole body of young chicks was investigated by the large-dose injection of [3H]phenylalanine. 2. Growth of germ-free chicks was significantly better than that of conventional controls. Wet weights of liver, spleen, duodenum, jejunum + ileum and caeca were heavier in conventional birds than in germ-free counterparts. 3. Fractional rates of protein synthesis were higher in jejunum + ileum and whole body of conventional birds than in those of germ-free birds. Amounts of protein synthesized were larger in liver, jejunum + ileum and caeca in the presence of the gut microflora. 4. When tissues were classified into gut + liver and the remainder of the carcass, in the presence of the gut microflora an enhanced protein synthesis in fractional and absolute rate was found in the gut + liver, which is in direct contact or in close association with micro-organisms, whereas virtually no effect of the gut micro-organisms was detected in the remainder of the carcass. 5. The contribution of protein synthesis of gut + liver to that of the whole body was larger in conventional chicks than in germ-free birds, whereas the reverse was true for the remainder of the carcass.     

Action of hypochlorous acid on the antioxidant protective enzymes superoxide dismutase, catalase and glutathione peroxidase.

The neutrophil enzyme myeloperoxidase generates hypochlorous acid (HOCl) at sites of inflammation. Glutathione peroxidase is very quickly inactivated by low concentration of HOCl. Inactivation of catalase is also rapid, but requires higher HOCl concentrations and the haem appears to be degraded. Inactivation of bovine CuZn superoxide dismutase is slower. Hence superoxide dismutase should not be easily inactivated by HOCl at sites of inflammation, which may contribute to its effectiveness as an anti-inflammatory agent and in minimizing reperfusion injury.     

Differences in monoamine oxidase activity between cultured noradrenergic and cholinergic sympathetic neurons

Two types of monoamine oxidase activity (MAO-A and MAO-B) help regulate the levels of biogenic amines such as catecholamines and serotonin. Although MAO-A has greater activity toward most catecholamines than MAO-B, no direct experiments have determined the types and levels of MAO activity that are normally expressed in noradrenergic neurons. Noradrenergic neurons from neonatal rat superior cervical ganglia were isolated and cultured under conditions that permit either continued expression of the noradrenergic phenotype or promote a transition to a predominantly cholinergic phenotype. After 14-21 days in vitro, neurons from both types of cultures were assayed for the type and amount of monoamine oxidase activity using tryptamine, a common substrate for both MAO-A and MAO-B. Neurons cultured under noradrenergic conditions expressed sevenfold greater MAO activity than neurons cultured under cholinergic conditions. Essentially all MAO activity in the noradrenergic cultures was inhibited by preincubation with 10(-8)-10(-9) M clorgyline, which indicated that this activity was primarily MAO-A. Cultures grown under cholinergic conditions exhibited 6- to 10-fold lower MAO-A activity and an 8- to 10-fold lower level of catecholamine synthesis from labeled precursors compared to neurons grown under noradrenergic conditions. These results directly demonstrate that high MAO-A activity is expressed in noradrenergic neurons in vitro. The corresponding decreases in both MAO-A specific activity and catecholamine synthesis as neurons become cholinergic in vitro suggest that the expression of the noradrenergic phenotype involves the coordinate regulation of degradative as well as synthetic enzymes involved in catecholamine metabolism.