Various characteristics of the structure and synthesis of procollagens produced by cultured skin fibroblasts from patients with Danlos-Ehlers syndrome type I

The electrophoretic mobilities of the collagen and procollagen type I and III chains synthesized by the fibroblasts isolated from patients with type I Ehlers-Danlos syndrome as well as a set of peptides obtained by splitting of pro alpha 1(I) and pro alpha 2(I) type I procollagens by cyanbromide are not different from the normal ones. The fact demonstrates the absence of long insertions or deletions, or the sufficient defects in intracellular chain modifications. The changes were also nor registered for the ratio of type I and III collagens from the digested by pepsin preparations of protein accumulating in the culture media of the cultured skin fibroblasts from patients. The studied strains of cultured fibroblasts from patients suffering the Ehlers-Danlos syndrome have the trend to increased accumulation of partially processed chains of proc alpha 1(I) and proc alpha 2(I) type I procollagen and to the increased ratio of pro alpha 1(I) to pro alpha 2(I).     

Comparative analysis of the structure of incompatibility plasmids N, P and W

Evolutionary relationships of the IncN plasmid R15 and other broad host range plasmids (IncN plasmids N3 and R46, IncP plasmids RP4 and R906, IncW plasmids Sa and R388) were studied by Southern blot hybridization technique. The IncN plasmids were shown to harbour homologous determinants for replication and conjugation. No homology was found between the rep and tra genes in R15 and in the IncW and IncP plasmids, respectively. The second rep region of the N3 plasmid is distinctive from the corresponding determinants in the IncN plasmids. Homology was demonstrated for the plasmid genes that mediate restriction and modification in R15 and N3, mercury resistance in R15 and R906, sulfanilamide resistance in R15, N3, R46, Sa, R388, and R906, streptomycin resistance in R15, R46 and Sa. The latter genes are different from the R906 SmR gene. In addition to the three known mobile elements in the plasmid R15, the fourth one (IS46) that is a part of the transposon Tn2353 was identified in this study. Besides, the third copy of this insertion sequence was found in the N3 plasmid.     

The nature of virus strains isolated from patients with poliomyelitis in the Byelorussian SSR 1967-1985

Oligonucleotide mapping of the RNA genome was applied for analysis of poliovirus clinical isolates in Byelorussia in 1967-1985. All the maps have been clearly shown to resemble the reference maps of the corresponding vaccine strains. Examination of the oligonucleotide maps of poliovirus isolates provides a measure of distribution of some of the mutations over the viral genome.     

The effect of leucine-enkephalin on the peristaltic reflex of the isolated guinea-pig ileum

Leucine (leu)-enkephalin depresses or inhibits the peristaltic reflex of the isolated guinea-pig ileum. Opiate antagonists (naloxone and nalorphine), choline esters (acetylcholine, methacholine and carbachol), cholinomimetics (muscarine and arecoline) and polypeptides which stimulate peristalsis (eledoisin and angiotensin) antagonize the peristaltic block caused by leu-enkephalin. On the other hand, nicotinic ganglionic stimulants (nicotine and dimethylphenylpiperazine) as well as muscarinic ganglionic stimulants (McN-A-343 and AHR-602) do not restore the peristaltic reflex abolished by leu-enkephalin. Thus the inhibitory effect of leu-enkephalin is due mainly to an action on myenteric ganglia as well as on axon terminals of the myenteric plexus subserving the peristaltic reflex. The inhibitory action of leu-enkephalin may be ascribed to the opiate as well as to the cholinoceptive sites in the nervous elements in the myenteric plexus. The blocking action of leu-enkephalin is not associated with ganglionic muscarinic M-1 receptors as well as with ganglionic nicotinic receptors in the myenteric plexus of the guinea-pig isolated ileum.     

The effect of acute and chronic ethanol administration on serum corticosterone concentration in rats

The effect of intraperitoneally (i.p.) and intragastrically (i.g.) administered ethanol solution, and the influence of voluntary ethanol uptake (20% v/v) on adrenocortical activity of adult male rats was studied. Both i.p. and i.g. ethanol administration resulted in a significant activation of adrenocortical mechanisms, while voluntary ethanol uptake failed to induce elevation of serum corticosterone concentration. No difference was found in blood ethanol concentration among these groups. The responsiveness of adrenocortical mechanisms was also tested in rats which were given the free choice between ethanol solution (5% v/v) and tap-water for three weeks. Unavoidable electric foot-shocks, as stressor, resulted in an elevation of serum corticosterone concentration in control animals, but this response was found to be significantly reduced in chronically ethanol drinking rats.     

Arterial hypoxia does not affect subchondral pressure and regional blood flow

The influence of arterial hypoxia on bone marrow pressure, regional blood flow and oxygen and carbon dioxide tensions was investigated by simultaneous and continuous measurements in the femoral condyles of 8 rabbits. Arterial hypoxia was obtained by hypoventilation. The subchondral gas tensions and regional blood flow were measured by a previously described technique based on mass spectrometry. Arterial hypoxia caused a significant decrease in subchondral oxygen tension and an increase in subchondral carbon dioxide tension. There was no significant change in bone marrow pressure and regional blood flow.     

A sensitive high performance liquid chromatographic method for determining small amounts of glycosylproteins

We developed a simple isocratic high performance liquid chromatography (HPLC) method for the quantitative determination of 5-hydroxymethyl-2-furfuraldehyde (5-HMF) liberated by mild hydrolysis of small amounts of glycosyl proteins. The absorbance of hydrolysate components after HPLC separation was recorded at 280 nm. To detect substances possibly interfering with the 5-HMF peak we always recorded the ratio of the peak heights A280 nm/A254 nm which was a constant value of 4.4. For each sample the blank was obtained by reduction with NaBH4 before hydrolysis with oxalic acid 1 mol/l. The best NaBH4/protein ratio was found to be 4 mg/mg. With this method we measured the nonenzymatic glycosylation (glycation) as 5-HMF in samples with a protein concentration as low as 0.8 mg/ml. 5-HMF produced per milligram of protein was independent from protein concentration for a wide range (0.8-10 mg/ml). The mean coefficient of variation for within assay and between precision was 6.8 and 11.6%, respectively. The 5-HMF measured on plasma proteins from normal subjects (n = 7) was 0.16 +/- 0.04 nmol/mg. Protein from insulin-dependent diabetic patients was 0.31 +/- 0.07 nmol/mg. With this method we succeeded in detecting an excessive glycation of platelet membrane proteins in 13 type-I diabetic patients.     

Inhibition of human natural killer activity by monolayers of primary cell cultures

Some primary and continuous cell cultures were tested for their capacity to regulate human natural killer (NK) activity. Primary cultures of endothelial cells, fetal fibroblasts, adult fibroblasts, amnion epithelial cells, renal parenchymal cells, and ovarian carcinoma cells inhibited NK activity when peripheral blood lymphocytes were preincubated on target cell monolayers for 18 h before testing the cytotoxicity against K-562. The supernatants of the inhibiting cell cultures were not suppressive. Prostaglandins or suppressive lymphocytes were not involved in the phenomenon. The binding capacity of the effector cells was not changed, suggesting that the suppressive signal was targeted at the cytolytic machinery of NK cells. The down-regulating capacity of the cell cultures weakened significantly during subculturing in vitro, and continuous cell lines were not inhibitory. The inactivation of NK cells may be one of the mechanisms by which target cells are protected from NK activity.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.