Human platelet factor 4 subunit association/dissociation thermodynamics and kinetics

Platelet factor 4 (PF4) monomers (7800 daltons) form dimers and tetramers in varying molar ratios under certain solution conditions [Mayo, K. H., & Chen, M. J. (1989) Biochemistry 28, 9469]. The presence of a simplified aromatic region (one Tyr and two His) and resolved monomer, dimer, and tetramer Y60 3,5 ring proton resonances makes study of PF4 aggregate association/dissociation thermodynamics and kinetics possible. PF4 protein subunit association/dissociation equilibrium thermodynamic parameters have been derived by 1H NMR (500MHz) resonance line-fitting analysis of steady-state Y60 3,5 ring proton resonance monomer-dimer-tetramer populations as a function of temperature from 10 to 40 degrees C. Below 10 degrees C and above 40 degrees C, resonance broadening and overlap severely impaired analysis. Enthalpic and entropic contributions to dimer association Gibb's free energy [-5.1 kcal/mol (30 degrees C)] are +2.5 +/- 1 kcal/mol and +26 +/- 7 eu, respectively, and for tetramer association Gibb's free energy [-5.7 kcal/mol (30 degrees C)], they are -7.5 +/- 1 kcal/mol and -7 +/- 3 eu, respectively. These thermodynamic parameters are consistent with low dielectric medium electrostatic/hydrophobic interactions governing dimer formation and hydrogen bonding governing tetramer formation. Association/dissociation kinetic parameters, i.e., steady-state jump rates, have been derived from exchange-induced line-width increases and from 1H NMR (500 MHz) saturation-transfer and spin-lattice (Tl) relaxation experiments. From dissociation jump rates and equilibrium constants, association rate constants were estimated. For dimer and tetramer equilibria at 30 degrees C, unimolecular dissociation rate constants are 35 +/- 10 s-1 for dimer dissociation and 6 +/- 2 s-1 for tetramer dissociation.(ABSTRACT TRUNCATED AT 250 WORDS)     

Cloning and characterization of the carp prolactin gene

A carp genomic DNA clone containing the carp prolactin (Prl) gene was isolated with carp Prl cDNA as a probe. The organization of the carp Prl gene was determined by restriction nuclease mapping and nucleotide sequencing. The Prl gene comprises approx. 2.8 kilobasepairs (kb) of DNA including the 5'-flanking region, five exons, four introns and the 3'-flanking region. Analysis of the 5'-flanking region reveals (1) the sequence TATATAAT at positions -38 to -31 upstream from the cap site which was found to be a guanine residue, and (2) the palindrome, CTCATTGCATATACAAATGAG at positions -79 to -59. The carp Prl gene matches with the reported cDNA except for one difference in coding region and five in the 3'-flanking region, while the encoded amino acid sequences are identical. The arrangement of exons and introns is very similar to that seen in carp GH as well as mammalian Prl, which, however, have much longer introns.     

Complementing amino acid substitutions within loop 6 of the alpha/beta-barrel active site influence the CO2/O2 specificity of chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase

Photosynthesis-deficient mutant 45-3B of the green alga Chlamydomonas reinhardtii contains a chloroplast mutation that causes valine-331 to be replaced by alanine within the large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase. This amino acid substitution occurs in loop 6 of the alpha/beta-barrel active site, three residues distant from catalytic lysine-334. The mutation reduces the specific activity of the enzyme and also reduces its CO2/O2 specificity factor by 42%, but the amount of holoenzyme is unaffected. In a previous study, an intragenic-suppressor mutation, named S40-9D, was selected that causes threonine-342 to be replaced by isoleucine, thereby increasing the CO2/O2 specificity of the mutant enzyme by 36%. To determine which other residues might be able to complement the original mutation, nine additional genetically independent revertants have now been analyzed. Another intragenic suppressor, represented by mutation S61-2J, causes glycine-344 to be replaced by serine. This change increases the CO2/O2 specificity of the mutant enzyme by 25%. Of the revertants recovered and analyzed, the mutant enzyme was improved only due to true reversion or by intragenic suppression mediated by substitutions at residues 342 or 344. Changes in the physical properties of the two pairs of complementing substitutions indicate that steric effects within loop 6 are responsible for the observed changes in the CO2/O2 specificity of the enzyme.     

Isotope trapping and positional isotope exchange with rat and chicken liver phosphoenolpyruvate carboxykinases

Isotope-trapping studies of the enzyme.MgGTP complex were carried out with rat liver cytosolic and chicken liver mitochondrial phosphoenolpyruvate carboxykinases. For the rat liver enzyme, MgGTP was partially trapped from both E.MgGTP and E.MgGTP.OAA complexes, consistent with a steady-state random mechanism. For the chicken liver enzyme, MgGTP was 100% trapped from the E.MgGTP.OAA complex, consistent with a steady-state ordered mechanism. The rate constants for the interaction of MgGTP with the free enzymes are approximately 10(7) M-1 S-1, somewhat lower than the diffusion limit for association. The dissociation rate for the enzyme.MgGTP complexes is 26-92 s-1, reflecting a tightly bound complex with high commitment to catalysis in the presence of oxaloacetate. Positional isotope-exchange studies were also carried out with phosphoenolpyruvate carboxykinases from rat and chicken. No exchange if the beta gamma-18O in [beta gamma-18O, gamma-18O3]GTP to form [beta-18O, gamma-18O3]GTP was detected in the absence of oxaloacetate. In the presence of oxaloacetate, no positional isotope exchange of [beta gamma-18O, gamma-18O3]GTP was detected during initial rate conditions. The results indicate that at least one of the products dissociates rapidly from the E.MgGDP.PEP.CO2 complex relative to the net rate of MgGTP formation from the E.MgGDP.PEP.CO2 complex. A rapid equilibrium between the central complexes in which the beta-phosphoryl of GDP is restricted with respect to torsional rotation cannot be excluded but is unlikely on the basis of the relative rates of catalysis and torsional rotation. The addition of Mn2+, an activator of phosphoenolpyruvate carboxykinase, did not influence the positional isotope-exchange results.(ABSTRACT TRUNCATED AT 250 WORDS)     

Differentiation of a mouse neuroblastoma variant cell line whose ornithine decarboxylase gene has been amplified.

Differentiation of mouse neuroblastoma cells has been shown to be accompanied by changes in polyamine metabolism and a decrease in polyamine content. We have previously shown that alpha-difluoromethyl ornithine, a suicide inhibitor of ornithine decarboxylase (ODC, EC 4.1.1.17) and suboptimal concentrations of dibutyryl cAMP (0.1 to 0.2 mM) are effective in inducing the differentiation of mouse Neuro-2a (N2a) neuroblastoma cells. Exogenously added putrescine or spermidine can block the action of DFMO and dibutyryl cAMP, suggesting that polyamines may play a regulatory role in neuroblastoma differentiation. We have now isolated from N2a cells a clonal variant line, DF-40, whose ODC gene has been amplified by 40-fold. The DF-40 cells overproduced the ODC enzyme and contained very high levels of putrescine, spermidine and spermine. Treatment of DF-40 cells with dibutyryl cAMP or DFMO/dibutyryl cAMP led to a more than 80% reduction in polyamine content. Such a decrease did not cause the DF-40 cells to differentiate. Polyamine content in the treated DF-40 cells was still comparable or higher than that in the undifferentiated N2a cells. In contrast, serum-deprivation induced full differentiation of DF-40 cells. Levels of polyamine in the differentiated DF-40 cells, however, were also found to be comparable to that in the undifferentiated N2a cells. Exogenously added polyamines could not block the differentiation of DF-40 cells induced by serum-deprivation, suggesting that the action of polyamines in regulating neuroblastoma differentiation may depend on the presence of serum factors.     

Expression of reg/PSP, a pancreatic exocrine gene: relationship to changes in islet beta-cell mass

A cDNA termed reg was recently isolated by differential screening of a library prepared from regenerating islets isolated from pancreatic remnants of rats subjected to 90% pancreatectomy and nicotinamide treatment. This led to speculation that this gene may be involved in expansion of beta-cell mass. In the current study we have measured reg expression after implantation and resection of a solid insulinoma tumor into rats, maneuvers known, respectively, to reduce and reexpand the volume of beta-cells in the islet. Animals with an implanted insulinoma tumor became profoundly hypoglycemic. Islet beta-cells declined from the normal 75% of total islet volume to less than 30%, in concert with a marked reduction in the reg mRNA level. Removal of the tumor resulted in a sharp increase in beta-cell replication, as measured by [3H]thymidine incorporation and a return to normal beta-cell volume within 4 days of tumor resection. This was associated with a transient induction in reg expression compared to that in tumor-bearing animals, effectively returning the amount of reg mRNA to the levels found in normal animals within 48 h; at later time points after tumor removal (3-7 days) reg expression declined, but then rose toward normal. In situ hybridization analysis localized the initial induction in reg mRNA expression to the exocrine pancreas. Continuous infusion of insulin into normal rats for 4 days, a maneuver that does not significantly reduce beta-cell mass, resulted in dramatically reduced insulin mRNA in islets, but no change in the levels of reg mRNA. We conclude that the diminution in pancreatic beta-cell mass caused by subcutaneous implantation of an insulinoma is associated with reduced reg gene expression and that the increase in beta-cell replication after resection of the tumor is preceded by return of reg gene expression toward normal.     

A cloned ompR-like gene of Streptomyces lividans 66 suppresses defective melC1, a putative copper-transfer gene

Expression of tyrosinase in Streptomyces requires functional MelC1 protein, which is postulated to transfer copper to apotyrosinase. We have previously isolated a mutant of Streptomyces lividans, HT32, that phenotypically suppressed mutations in cloned melC1 (H.-C. Tseng and C. W. Chen, in preparation). Plasmid pLUS132, containing an ATG to ATA transition at the initiation codon of melC1, was used for cloning the suppressor gene from HT32. A 1687 bp suppressor DNA was isolated that contained two characteristic Streptomyces coding sequences: a 217-amino-acid open reading frame (cutR) and a truncated open reading frame (cutS) downstream. Subcloning analysis attributed the phenotypic suppression activity to the putative cutR gene from HT32. The putative CutR exhibited similarity to the response regulator OmpR of the osmoregulatory signal-transduction system in Escherichia coli. The truncated CutS resembled, to a lesser degree, the N-terminus of EnvZ, the histidine protein kinase counterpart of OmpR. DNA hybridizing to the cloned cutR-cutS sequence was detected in 16 other Streptomyces species. We postulate that the putative cutR-cutS operon regulates copper metabolism in Streptomyces.     

Calcium in bacteria: a solution to which problem?

Calcium and calcium-binding proteins including those resembling calmodulin are implicated in numerous diverse processes in bacteria. These processes include chemotaxis, sporulation, virulence, the transport of sugars and proteins, phosphorylation, heat shock, the initiation of DNAS replication, septation, nucleoid structure, nuclease activity and recombination, the stability of the envelope, and phospholipids synthesis and configuration. That such varied processes should have a common factor, calcium, suggests major underlying principles of calcium metabolism metabolism which have yet to be discovered.     

Coordinated regulation of vascular endothelial cell growth and prostacyclin production by epidermal growth factor: Evidence of clonal variations among rat aortic endothelial cells

Summary Rat aortic endothelial cells were found to exhibit clonal variations in response to EGF stimulation in cell growth and prostacyclin synthesis. EGF-induced growth and prostacyclin synthesis appeared to be regulated in a coordinated manner in that a clone with a higher response to EGF growth stimulation also exhibited a higher response to EGF-stimulated prostacyclin synthesis. This observation implys a possible involvement of prostacyclin synthesis in some of the biological effects of EGF on vascular endothelial cells.     

Transfer, expression, and inheritance of salmonid growth hormone genes in channel catfish, Ictalurus punctatus, and effects on performance traits.

We examined expression and inheritance of salmonid growth hormone genes RSVLTR-rtGH1 cDNA and RSVLTR-csGH cDNA, transferred to channel catfish (Ictalurus punctatus) by microinjection. One to 9 copies of the foreign DNA were inserted in either head-to-tail tandem array at single insertion sites or single copies at multiple insertion sites. All P1 transgenic catfish evaluated produced salmonid growth hormone regardless of the construct. Five P1 x P1 matings were accomplished. The spawning rate and fertility of these P1 transgenics in artificial spawning conditions were comparable to those of normal channel catfish. In two of three years, 100% spawning and 100% hatch were obtained. Percent transgenic progeny observed in the five matings were 20, 52, 7, 47, and 0%, which was lower (P < 0.001, chi 2) than the 75% inheritance expected assuming the P1 brood stock had at least one copy of the foreign gene integrated and were not mosaics in the germ line. At least 7 of 10 P1 were mosaics, and a minimum of 2 of 10 P1 did not possess the salmonid growth hormone genes in their germ line. P1 transgenics grew at the same rate as their nontransgenic full siblings, which is not surprising because the P1 were mosaics. F1 transgenic progeny in two families possessing RSVLTR-csGH cDNA grew 26% faster, to 40 to 50 gm, than their nontransgenic full siblings when evaluated communally. One F1 progeny group produced by RSVLTR-rtGH1 cDNA x RSVLTR-csGH cDNA mating and one F1 progeny group (parents either RSVLTR-rtGH1 cDNA or RSVLTR-csGH cDNA) grew at the same rate as normal full siblings when grown communally to 25 gm and 60 mg, respectively. In families where F1 progeny grew faster than controls, the range in body weight and coefficient of variation for the transgenic full siblings were less than those for controls. In families where F1 progeny grew at the same rate as controls, range in body weight and coefficient of variation were similar for transgenic and normal individuals. The percent deformities observed in P1 transgenics (13.6%) was higher (P < 0.05) than in microinjected P1 nontransgenics (5.1%). Percent deformities in transgenics and control F1 channel catfish was not different (p > 0.05; 0.5 and 2.8%, respectively).