Expression of Putative Stem Cell Marker,Hepatocyte Nuclear Factor 4 Alpha,in Mammary Gland of Water Buffalo

Buffaloes account for more than 56% of total milk production in India. Cyclic remodeling of mammary glands of human, mice, cow, sheep, and goat is determined by mammary stem cells. It is logical to assume that buffalo mammary gland will have mammary stem/progenitor cells. Thus far, no report exists on identification of buffalo mammary stem cells. Hepatocyte nuclear factor 4 alpha (HNF4A) is a candidate marker for hepatic progenitor cells and has recently been suggested as a marker of bovine mammary stem/progenitor cells. We hypothesized that (1 Pasha TN, Hayat Z. Present situation and future perspective of buffalo production in Asia. J Anim Plant Sci 2012; 22(3 supple.):250–256. [Google Scholar]) HNF4A identifies putative buffalo mammary stem/progenitor cells and (2 NDDB. National Dairy Development Board. 2015. http://www.nddb.org/English/Statistics/Pages/Milk-Production.aspx. Accessed May 10, 2015. [Google Scholar]) the number of HNF4A-positive cells increases during mastitis. Sixteen buffalo mammary samples were collected from a local slaughterhouse. Hematoxylin and eosin staining were performed on 5-micron thick sections and on the basis of gross examination and histomorphology of the mammary glands, physiological stages of the animals were estimated as non-lactating (n = 4), mastitis (n = 9), and prepubertal (n = 3). In total, 24048 cells were counted (5–10 microscopic fields/animal; n = 16 animals) of which, 40% cells were mammary epithelial cells (MEC) and 60% cells were the stromal cells. The percentage of MEC in non-lactating animals was higher compared to mastitic animals (47.3% vs. 37.3%), which was likely due to loss of MEC in mastitis. HNF4A staining was observed in nuclei of MEC of ducts, alveoli, and stromal cells. Basal location and low frequency of HNF4A-positive MEC (ranges from 0.4–4.5%) were consistent with stem cell characteristics. Preliminary study showed coexpression of HNF4A with MSI1 (a mammary stem cell marker in sheep), suggesting HNF4A was likely to be a putative mammary stem/progenitor cell marker in buffalo. HNF4A-positive MEC (basal and luminal; light and dark stained) tended to be higher in non-lactating than the mastitic animals (8.73 ± 1.71% vs. 4.29 ± 1.19%; P = 0.07). The first hypothesis that HNF4A identify putative mammary stem/progenitor cells was confirmed but the second hypothesis that the number of mammary stem/progenitor cells decreases during mastitis was unsupported. This is the first report outlining the expression of HNF4A and identification of putative mammary stem/progenitor cells in buffalo mammary gland.     

Molecular diversity and genetic variability of kernel tocopherols among maize inbreds possessing favourable haplotypes of γ-tocopherol methyl transferase (ZmVTE4)

Journal of Plant Biochemistry and Biotechnology - Vitamin E deficiency is a serious health concern in humans. Biofortification of maize kernel with high vitamin E (α-tocopherol) provides...     

Butanol production from wheat straw hydrolysate using <Emphasis Type="Italic">Clostridium beijerinckii</Emphasis>

In these studies, butanol (acetone butanol ethanol or ABE) was produced from wheat straw hydrolysate (WSH) in batch cultures using Clostridium beijerinckii P260. In control fermentation 48.9 g L⁻¹ glucose (initial sugar 62.0 g L⁻¹) was used to produce 20.1 g L⁻¹ ABE with a productivity and yield of 0.28 g L⁻¹ h⁻¹ and 0.41, respectively. In a similar experiment where WSH (60.2 g L⁻¹ total sugars obtained from hydrolysis of 86 g L⁻¹ wheat straw) was used, the culture produced 25.0 g L⁻¹ ABE with a productivity and yield of 0.60 g L⁻¹ h⁻¹ and 0.42, respectively. These results are superior to the control experiment and productivity was improved by 214%. When WSH was supplemented with 35 g L⁻¹ glucose, a reactor productivity was improved to 0.63 g L⁻¹ h⁻¹ with a yield of 0.42. In this case, ABE concentration in the broth was 28.2 g L⁻¹. When WSH was supplemented with 60 g L⁻¹ glucose, the resultant medium containing 128.3 g L⁻¹ sugars was successfully fermented (due to product removal) to produce 47.6 g L⁻¹ ABE, and the culture utilized all the sugars (glucose, xylose, arabinose, galactose, and mannose). These results demonstrate that C. beijerinckii P260 has excellent capacity to convert biomass derived sugars to solvents and can produce over 28 g L⁻¹ (in one case 41.7 g L⁻¹ from glucose) ABE from WSH. Medium containing 250 g L⁻¹ glucose resulted in no growth and no ABE production. Mixtures containing WSH + 140 g L⁻¹ glucose (total sugar approximately 200 g L⁻¹) showed poor growth and poor ABE production. Mention of trade names or commercial products in this article is solely for the purpose of providing scientific information and does not imply recommendation or endorsement by the United States Department of Agriculture.     

Microbial diversity and function in crystalline basement beneath the Deccan Traps explored in a 3 km borehole at Koyna,western India

Deep terrestrial subsurface represents a huge repository of global prokaryotic biomass. Given its vastness and importance, microbial life within the deep subsurface continental crust remains under-represented in global studies. We characterize the microbial communities of deep, extreme and oligotrophic realm hosted by crystalline Archaean granitic rocks underneath the Deccan Traps, through sampling via 3000 m deep scientific borehole at Koyna, India through metagenomics, amplicon sequencing and cultivation-based analyses. Gene sequences 16S rRNA (7.37 × 10⁶) show considerable bacterial diversity and the existence of a core microbiome (5724 operational taxonomic units conserved out of a total 118,064 OTUs) across the depths. Relative abundance of different taxa of core microbiome varies with depth in response to prevailing lithology and geochemistry. Co-occurrence network analysis and cultivation attempt to elucidate close interactions among autotrophic and organotrophic bacteria. Shotgun metagenomics reveals a major role of autotrophic carbon fixation via the Wood–Ljungdahl pathway and genes responsible for energy and carbon metabolism. Deeper analysis suggests the existence of an ‘acetate switch’, coordinating biosynthesis and cellular homeostasis. We conclude that the microbial life in the nutrient- and energy-limited deep granitic crust is constrained by the depth and managed by a few core members via a close interplay between autotrophy and organotrophy.     

DNA methylation regulates Microtubule-associated tumor suppressor 1 in human non-small cell lung carcinoma

Microtubule associated tumor suppressor 1 (MTUS1) has been recognized as a tumor suppressor gene in multiple cancers. However, the molecular mechanisms underlying the regulation of MTUS1 are yet to be investigated. This study aimed to clarify the significance of DNA methylation in silencing MTUS1 expression. We report that MTUS1 acts as tumor suppressor in non-small cell lung carcinoma (NSCLC). Analysis of in silico database and subsequent knockdown of DNMT1 suggested an inverse correlation between DNMT1 and MTUS1 function. Interestingly, increased methylation at MTUS1 promoter is associated with low expression of MTUS1. Treatment with DNA methyltransferases (DNMTs) inhibitor, 5-aza-2′-deoxycytidine (AZA) leads to both reduced promoter methylation accompanied with enrichment of H3K9Ac and enhanced MTUS1 expression. Remarkably, knockdown of MTUS1 showed increased proliferation and migration of NSCLC cells in contrast to diminished proliferation and migration, upon treatment with AZA. We concluded that low expression of MTUS1 correlates to DNA methylation and histone deacetylation in human NSCLC.     

Enhancement in Iron Absorption on Intake of Chemometrically Optimized Ratio of Probiotic Strain Lactobacillus plantarum 299v with Iron Supplement Pearl Millet

Biological Trace Element Research - This research article aims to establish the intake ratio of probiotic Lactobacillus plantarum 299v with iron supplement pearl millet by central composite design...     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.