Enzymes of the xylotrophic basidiomycete Lentinus edodes F-249 in the course of morphogenesis

It has been shown that the fungus Lentinus edodes grown on a solid wort agar substrate produces intracellular enzymes, including Mn-dependent peroxidase, laccase, and tyrosinase as a family of isoforms. The composition of the complex (containing one to four forms of each enzyme) varied during the basidiomycete life cycle. The activity of oxidases was maximal at the stage of nonpigmented mycelium and at the stages of a brown mycelial mat and a fruit body. The activity of tyrosinase increased in the course of mycelium pigmentation and had two maxima: at the stage of a brown mycelial mat and at the stage of a fruit body. Laccase and tyrosinase activities were shown to increase sharply upon addition of oak sawdust extract to the culture medium as compared with the enzyme activities of mycelium grown on wort agar alone. It was established that the effect of phenol oxidase substrates on the growing mycelium consists in a twofold acceleration of the process of morphogenesis in the fungus L. edodes.     

Sentinel systems on the razor's edge: effects of warming on Arctic geothermal stream ecosystems

The Earth is experiencing historically unprecedented rates of warming, with surface temperatures projected to increase by 3–5 °C globally, and up to 7.5 °C in high latitudes, within the next century. Knowledge of how this will affect biological systems is still largely restricted to the lower levels of organization (e.g. species range shifts), rather than at the community, food web or ecosystem level, where responses cannot be predicted from studying single species in isolation. Further, many correlational studies are confounded with time and/or space, whereas experiments have been mostly confined to laboratory microcosms that cannot capture the true complexity of natural ecosystems. We used a ‘natural experiment’ in an attempt to circumvent these shortcomings, by characterizing community structure and trophic interactions in 15 geothermal Icelandic streams ranging in temperature from 5 °C to 45 °C. Even modest temperature increases had dramatic effects across multiple levels of organization, from changes in the mean body size of the top predators, to unimodal responses of species populations, turnover in community composition, and lengthening of food chains. Our results reveal that the rates of warming predicted for the next century have serious implications for the structure and functioning of these fragile ‘sentinel’ ecosystems across multiple levels of organization.     

Lectin activity of Lentinus edodes

The hemagglutinating activity of submerged mycelium and culture liquid for four strains of Lentinus edodes (Berk.) Sing [L. edodes (Berk.) Pegler] was studied in the search for lectins. The hemagglutinating activity of culture liquid was substantially higher, compared with mycelium. The carbohydrate-binding capacity of the agglutinins was established, and the lectin activity of extracts from mycelia grown on several agar media was elucidated in relation to fruiting. The lectin activity of L. edodes was examined at different morphogenetic steps: mycelium, brown mycelial film, primordium, and fruiting body. Hemagglutination titers at the brown film step were higher than in the mycelium, whereas activity at the primordial and fruiting bodies steps decreased. Lectins seem to be involved in the formation of hyphal aggregates of brown mycelial film.     

Identification of proteins overexpressed in papillary thyroid tumors

A modified method of proteome comparative analysis based on preliminary removal of cell structural proteins by extraction using salt buffer and subsequent separation of extracts by two-dimensional gel electrophoresis was developed. Identification of differentially expressed proteins by mass spectrometry has revealed three proteins with noticeably increased level of synthesis in most samples of papillary thyroid tumors compared to normal tissues. An increase in ubiquitin content was found for the first time. Oncomarker search efficiencies by two-dimensional gel electrophoresis and bioinformatic search were compared.     

Lipoproteins from normolipidemic and dyslipidemic subjects modify the thromboxane A2 generation by platelets in clotting human blood

The study was performed to investigate the influence of lipoproteins (LP) on the thromboxane (TX) A₂ formation capacity of platelets in clotting whole blood in vitro. The different lipoprotein fractions VLDL, LDL, HDL₂ and HDL₃ were isolated from blood of normo- or dyslipidemic volunteers by ultracentrifugation. These lipoproteins were incubated in blood with different levels of serum total cholesterol (TC) taken from normolipidemics (TC < 200 mg/dl), moderate hypercholesterolemics (TC: 200–250 mg/dl) or subjects with high cholesterol level (TC > 250 mg/dl), respectively. The amount of serum TXA₂ formed within 60 min at 37°C was measured by enzyme immunoassay. The results obtained show that the efficacy of separate LP fractions to influence the TXA₂ production depends not only on the type of LP fraction but also on the source of plasma used for isolation of LP and on the cholesterol level in the blood for incubation: LDL taken from normolipidemics or moderate hyperlipidemics inhibited the TXA₂ formation in blood from normolipidemics (P < 0.02, respectively), but enhanced it in blood from persons with moderate hypercholesterolemia (P < 0.05). LDL from hyperlipidemics enhanced TXA₂ production in blood from hyperlipidemics (P < 0.05). The HDL₂ fractions inhibited the TXA₂ formation in blood from normo- and hypercholesterolemics (P < 0.02, resp.), but there was no effect of HDL₂ in clotting blood from persons with moderate hypercholesterolemia. All HDL₃ fractions tested inhibited the TXA₂ formation in all types of blood used for clotting (P < 0.02, resp.), probably due to their great cholesterol accepting capacity.     

Functioning of Enzyme Systems of Digestive and Non-Digestive Organs in Adult Rats Depends on Quality of Nutrition in Early Ontogenesis

It is revealed that restriction of protein in nutrition of rat pups in early ontogenesis, at the period of transition from the mixed to the definitive nutrition, produces change of structural parameters and functioning of digestive enzymes in various parts of small intestine (duodenum, jejunum, and ileum) and in large intestine as well as of these hydrolases in liver and kidney in adult life. The disturbance of quality of nutrition in early ontogenesis seems to affect negatively digestive functions of small intestine and trophic-barrier function of large intestine, liver, and kidney, which can promote development of diseases not only of the gastrointestinal tract, but also of other organs.     

Synthesis and functional activity of translation initiation regions in mRNA. 20-base polyribonucleotides from the replicase gene of phage MS2 and fr

Three 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAACAUGAAGAAUACCCAUG (III), corresponding to the minimal initiation region for the replicase gene of phage MS2 and fr or having some differences were synthesized using enzymatic methods. The template activity of the synthesized polynucleotides in initiation and their capacity to bind phage coat protein were studied under conditions optimal for native mRNA. Polynucleotides I and II exhibit template activity comparable to that of the native phage RNA fragments. Polynucleotide III with the destroyed SD sequence dit not manifest any functional activity either as template or in binding to MS2 phage coat protein.