A New Damselfly Family from the Upper Palaeocene of Argentina

A new family of damselflies, based on Latibasalia elongata gen. et sp. nov. and L. quispeae gen. et sp. nov., is erected from the Upper Palaeocene Maíz Gordo Formation, north-western Argentina. Latibasaliidae fam. nov. can be included in the Zygoptera: Caloptera: Eucaloptera: Amphipterygida: Amphipterygoidea. Its phylogenetic relationships within the clade Eucaloptera Bechly, 1996 are discussed. Within Amphipterygoidea, Latibasaliidae could be closely related to Pseudolestidae or to the 'thaumatoneurid' genera Petrolestes and Congqingia because they share the absence of secondary antenodal crossveins of first and second rows and the absence of antesubnodal crossveins. These characters could be potential synapomorphies of these taxa but they are somewhat homoplastic within the Zygoptera.     

Circulating Tumor Cell Composition in Renal Cell Carcinoma

PurposeDue to their minimal-invasive yet potentially current character circulating tumor cells (CTC) might be useful as a “liquid biopsy” in solid tumors. However, successful application in metastatic renal cell carcinoma (mRCC) has been very limited so far. High plasticity and heterogeneity of CTC morphology challenges currently available enrichment and detection techniques with EpCAM as the usual surface marker being underrepresented in mRCC. We recently described a method that enables us to identify and characterize non-hematopoietic cells in the peripheral blood stream with varying characteristics and define CTC subgroups that distinctly associate to clinical parameters. With this pilot study we wanted to scrutinize feasibility of this approach and its potential usage in clinical studies.ResultsWe detected CTC with epithelial, mesenchymal, stem cell-like or mixed-cell characteristics at different time-points during anti-angiogenic therapy. The presence and quantity of N-cadherin-positive or CD133-positive CTC was associated with inferior PFS. There was an inverse correlation between high expression of HIF1A, VEGFA, VEGFR and FGFR and the presence of N-cadherin-positive and CD133-positive CTC.ConclusionsPatients with mRCC exhibit distinct CTC profiles that may implicate differences in therapeutic outcome. Prospective evaluation of phenotypic and genetic CTC profiling as prognostic and predictive biomarker in mRCC is warranted.     

Phytophthora and Pythium Associated with Feeder Root Rot of Citrus in the Transvaal Province of South Africa

Mild to extensive feeder root rot was present in all 23 orchards, with trees showing symptoms of citrus decline from nine areas in the Transvaal Province of South Africa. Phytophthora nicotianae and Pythium spp. were isolated from diseased roots and rhizosphere soils in all areas sampled. Isolations from diseased feeder roots showed P. nicotianae present in 26% of orchards during Spring and 61% of orchards during Autumn, while Pythium spp. were present in 56% of orchards during Spring and 65% of orchards during Autumn. In isolations from baited rhizosphere soils, P. nicotianae was present in 56% of orchards during Spring and 52% of orchards during Autumn, while Pythium spp. were present in 69% of orchards during Spring and 82% of orchards during Autumn. In rhizosphere soils, the mean population density of Pythium spp. was higher than that of P. nicotianae throughout the season. Only P. nicotianae was consistently isolated during thesurvey. Different Pythium spp. were isolated of which two were tentatively identified as P. paroecandrum and Pythium‘Gp.G’.     

Rapid screening of the fermentation profiles of wine yeasts by Fourier transform infrared spectroscopy

A rapid screening method for the evaluation of the major fermentation products of Saccharomyces wine yeasts was developed using Fourier transform infrared spectroscopy and principal component factor analysis. Calibration equations for the quantification of volatile acidity, glycerol, ethanol, reducing sugar and glucose concentrations in fermented Chenin blanc and synthetic musts were derived from the Fourier transform infrared spectra of small-scale fermentations. The accuracy of quantification of volatile acidity in both Chenin blanc and synthetic must was excellent, and the standard error of prediction was 0.07 g l(-1) and 0.08 g l(-1), respectively. The respective standard error of prediction in Chenin blanc and synthetic musts for ethanol was 0.32% v/v and 0.31% v/v, for glycerol was 0.38 g l(-1) and 0.32 g l(-1), for reducing sugar in Chenin blanc must was 0.56 g l(-1) and for glucose in synthetic must was 0.39 g l(-1). These values were in agreement with the accuracy obtained by the respective reference methods used for the quantification of the components. The screening method was applied to quantify the fermentation products of glycerol-overproducing hybrid yeasts and commercial wine yeasts. Principal component factor analysis of the fermentation data facilitated an overall comparison of the fermentation profiles (in terms of the components tested) of the strains. The potential of Fourier transform infrared spectroscopy as a tool to rapidly screen the fermentative properties of wine yeasts and to speed up the evaluation processes in the initial stages of yeast strain development programs is shown.     

Food niche separation between four sympatric Namib Desert carnivores

The diet of four sympatric carnivore species was established by analyzing scats collected during 1978-1980, a period of increasing drought in the Namib Desert. Termites were especially important in the diet of Aardwolves and Bat-eared foxes and the food spectrum was not broadened in response to increased aridity. Black-backed jackals utilized a wide range of prey items, especially rodents and lagomorphs, while the Cape fox largely depended on murid rodents, but also took lagomorphs and insects. Separation in use of space and times of activity between the four species also occurred.     

Phorbol ester induces tyrosine phosphorylation in normal and abnormal human B lymphocytes

Tumor-promoting phorbol esters have been found to bind and activate phospholipid/Ca2+-dependent or C-kinase, and several of their effects, including proliferative responses in lymphocytes, have been assumed to be related to activity of this enzyme. However, phorbol esters have also recently been found to stimulate tyrosine phosphorylation in certain other cell types, and we therefore studied tyrosine kinase activity in normal and chronic lymphocytic leukemia (CLL) peripheral blood B lymphocytes stimulated with phorbol ester. High levels of tyrosine labeling were observed in unstimulated cells with major endogenous substrates of 75K, 66K, 43K, and 28K in Triton-soluble material, and of 56K to 61K in Triton-insoluble material; this profile was essentially similar in normal and CLL B cells. Treatment with phorbol ester for time periods varying from 20 min to 48 hr led to qualitative increases in tyrosine labeling of these phosphoproteins, as measured both in vitro and in intact cells "in vivo." Although the relative abundance of tyrosine phosphorylation as a percentage of total labeling was variable due to concomitant enhancement of serine and threonine phosphorylation, exogenous peptide substrate assays confirmed the increased tyrosine kinase activity quantitatively. Enhanced tyrosine phosphorylation was succeeded or accompanied in both normal and abnormal B cells by cellular activation, as judged by increased [3H]thymidine uptake, and terminal differentiation of CLL cells. These findings provide further evidence implicating tyrosine kinases in B lymphocyte activation.     

OR3 operator of bacteriophage λ in a 23 base-pair DNA fragment: Sequence-specific 1H NMR assignments for the non-labile protons and comparison with the isolated 17 base-pair operator

Sequence-specific ¹H NMR assignments are presented for a non-selfcomplementary 23-base-pair DNA duplex of molecular weight 15,000 daltons, containing the O_R3 repressor binding site of bacteriophage as the central core. The NMR techniques used were mainly phase-sensitive two-dimensional NOE and 2Q spectroscopy, the latter to overcome overlap problems within the spectral region of the deoxyribose spin-systems. Direct sequential NOE connectivities are observed between adenine 2H and deoxyribose 1 protons. We propose the use of these connectivities as a check of the assignments of C1 and A2 protons, which have independently been derived via other assignment pathways.Abbreviation COSY 2-dimensional correlated spectroscopy - NOESY 2-dimensional nuclear-Overhauser-enhancement spectroscopy - RELAYED-COSY 2-dimensional relayed coherence transfer spectroscopy - 2Q two-quantum - ppm parts per million - 23-bp DNA d-(ATCTATCACCGCAAGGGATAAAT) · d-(ATTTATCCCTTGCGGTGATAGAT) - 17-bp DNA (O_R3) d-(TATCACCGCAAGGGATA) · d-(TATCCCTTGCGGTGATA) - d_i(X;Y) intra-residue distance between protons X and Y - d_s(X;Y) sequential distance between protons X and Y located in sequentially neighbouring nucleotides, where the direction from X to Y is always from 5 to 3     

Group-specific component (vitamin D binding protein) prevents the interaction between G-actin and profilin

Profilin purified from human platelets formed a 1:1 molar ratio complex with rabbit skeletal muscle G-actin but was displaced by purified serum Gc (vitamin D binding protein) in a dose-dependent fashion as assessed by chromatography and ultrafiltration. This suggested that Gc and profilin competed for the same binding area on G-actin, with Gc-G-actin complexes being more stable than profilin-G-actin complexes in vitro. The binding domain for Gc on G-actin was localized to a 16,000-Da C-terminal fragment of G-actin generated by Staphylococcus aureus V8 protease, as judged by comigration on two-dimensional electrophoresis and also by overlaying electrophoresis gels with 125I-Gc. Previous studies have reported that residues 374 and 375 of G-actin are essential for binding of profilin. In this study, experiments involving tryptic removal of Cys-374 labeled with the fluorescent probe N-(iodoacetyl)-N'-(5-sulfo-1-naphthyl)-ethylenediamine showed that these C-terminal amino acids were not necessary for interaction with Gc.     

Monitoring the purification by high-performance liquid chromatography of cardiotoxins from Naja mossambica mossambica using phase-sensitive two-dimensional nuclear magnetic resonance

High-resolution phase-sensitive two-dimensional proton nuclear magnetic resonance was used to monitor the preparation by high-performance liquid chromatography of homogeneous proteins from the venom of Naja mossambica mossambica. This resulted in the characterization of a heterogeneous protein preparation VII2, which had been used in earlier structural studies by NMR, as well as a homogeneous protein CTXIIb and a nearly homogeneous protein fraction CTXIIa, which are now both subject to further investigations of their solution conformations.