Structure Analysis of Two <Emphasis Type="Italic">Toxoplasma gondii</Emphasis> and <Emphasis Type="BoldItalic">Neospora caninum</Emphasis> Satellite DNA Families and Evolution of Their Common Monomeric Sequence

A family of repetitive DNA elements of approximately 350 bp—Sat350—that are members of Toxoplasma gondii satellite DNA was further analyzed. Sequence analysis identified at least three distinct repeat types within this family, called types A, B, and C. B repeats were divided into the subtypes B1 and B2. A search for internal repetitions within this family permitted the identification of conserved regions and the design of PCR primers that amplify almost all these repetitive elements. These primers amplified the expected 350-bp repeats and a novel 680-bp repetitive element (Sat680) related to this family. Two additional tandemly repeated high-order structures corresponding to this satellite DNA family were found by searching the Toxoplasma genome database with these sequences. These studies were confirmed by sequence analysis and identified: (1) an arrangement of AB1CB2 350-bp repeats and (2) an arrangement of two 350-bp-like repeats, resulting in a 680-bp monomer. Sequence comparison and phylogenetic analysis indicated that both high-order structures may have originated from the same ancestral 350-bp repeat. PCR amplification, sequence analysis and Southern blot showed that similar high-order structures were also found in the Toxoplasma-sister taxon Neospora caninum. The Toxoplasma genome database ( ) permitted the assembly of a contig harboring Sat350 elements at one end and a long nonrepetitive DNA sequence flanking this satellite DNA. The region bordering the Sat350 repeats contained two differentially expressed sequence-related regions and interstitial telomeric sequences.     

Enhanced anandamide degradation is associated with neuronal apoptosis induced by the HIV-1 coat glycoprotein gp120 in the rat neocortex

Human immunodeficiency virus type-1 coat glycoprotein gp120 causes delayed apoptosis in rat brain neocortex. Here, we investigated the possible role of the endocannabinoid system in this process. It is shown that gp120 causes a time-dependent increase in the activity and immunoreactivity of the anandamide (AEA)-hydrolyzing enzyme fatty acid amide hydrolase (FAAH), paralleled by increased activity of the AEA membrane transporter and decreased endogenous levels of AEA. The AEA-synthesizing phospholipase D and the AEA-binding receptors were not affected by gp120. None of the changes induced by gp120 in the cortex were induced by bovine serum albumin, nor were they observed in the hippocampus of the same animals. Also, the activity of 5-lipoxygenase, which generates AEA derivatives able to inhibit FAAH, decreased down to approximately 25% of the control activity upon gp120 treatment, due to reduced protein level ( approximately 45%). In addition, the FAAH inhibitor methyl-arachidonoyl fluorophosphonate significantly reduced gp120-induced apoptosis in rat brain neocortex, whereas selective blockers of AEA membrane transporter or of AEA-binding receptors were ineffective. Taken together, these results suggest that gp120, by activating FAAH, decreases endogenous levels of AEA, and the latter effect seems instrumental in the execution of delayed neuronal apoptosis in the brain neocortex of rats.     

Developmental loss and resistance to MPTP toxicity of dopaminergic neurones in substantia nigra pars compacta of gamma-synuclein, alpha-synuclein and double alpha/gamma-synuclein null mutant mice

The growing body of evidence suggests that intermediate products of alpha-synuclein aggregation cause death of sensitive populations of neurones, particularly dopaminergic neurones, which is a critical event in the development of Parkinson's disease and other synucleinopathies. The role of two other members of the family, beta-synuclein and gamma-synuclein, in neurodegeneration is less understood. We studied the effect of inactivation of gamma-synuclein gene on mouse midbrain dopaminergic neurones. Reduced number of dopaminergic neurones was found in substantia nigra pars compacta (SNpc) but not in ventral tegmental area (VTA) of early post-natal and adult gamma-synuclein null mutant mice. Similar reductions were revealed in alpha-synuclein and double alpha-synuclein/gamma-synuclein null mutant animals. However, in none of these mutants did this lead to significant changes of striatal dopamine or dopamine metabolite levels and motor dysfunction. In all three studied types of null mutants, dopaminergic neurones of SNpc were resistant to methyl-phenyl-tetrahydropyridine (MPTP) toxicity. We propose that both synucleins are important for effective survival of SNpc neurones during critical period of development but, in the absence of these proteins, permanent activation of compensatory mechanisms allow many neurones to survive and become resistant to certain toxic insults.     

Structural differences among hemagglutinins of influenza A virus subtypes are reflected in their antigenic architecture: analysis of H9 escape mutants

We used a panel of monoclonal antibodies to H9 hemagglutinin to select 18 escape mutants of mouse-adapted influenza A/Swine/Hong Kong/9/98 (H9N2) virus. Cross-reactions of the mutants with the antibodies and the sequencing of hemagglutinin genes revealed two minimally overlapping epitopes. We mapped the amino acid changes to two areas of the recently reported three-dimensional structure of A/Swine/Hong Kong/9/98 hemagglutinin. The grouping of the antigenically relevant amino acid positions in H9 hemagglutinin differs from the pattern observed in H3 and H5 hemagglutinins. Several positions in site B of H3 hemagglutinin are distributed in two sites of H9 hemagglutinin. Unlike any subtype analyzed so far, H9 hemagglutinin does not contain an antigenic site corresponding to site A in H3 hemagglutinin. Positions 145 and 193 (H3 numbering), which in H3 hemagglutinin belong to sites A and B, respectively, are within one site in H9 hemagglutinin. This finding is consistent with the peculiarity of the three-dimensional structure of the H9 molecule, that is, the absence from H9 hemagglutinin of the lateral loop that forms site A in H3 and the equivalent site in H5 hemagglutinins. The escape mutants analyzed displayed phenotypic variations, including decreased virulence for mice and changes in affinity for sialyl substrates. Our results demonstrate a correlation between intersubtype differences in three-dimensional structure and variations among subtypes in the distribution of antigenic areas. Our findings also suggest that covariation and pleiotropic effects of antibody-selected mutations may be important in the evolution of H9 influenza virus, a possible causative agent of a future pandemic.     

Chronic somatostatin treatment affects pituitary gonadotrophs, ovaries and onset of puberty in rats

The effects of chronic somatostatin (SRIH-14) treatment on the pituitary gonadotrophs (FSH and LH cells) and ovaries of female Wistar rats were examined. Females were given 20 microg/100 g b.w. twice per day from the immature (23rd day) till the adult period of life (71st day). The onset of puberty was determined by daily examination for vaginal opening. The peroxidase-antiperoxidase immunocytochemical procedure was used to study the gonadotrophs. Changes in the number per unit area (mm2), cell volume and volume densities of LH- and FSH-immunoreactive cells were evaluated by morphometry and stereology. Ovaries were analysed by simple point counting of follicles and corpora lutea (CL). Follicles were divided by size according to the classification of Gaytán and Osman. The mitotic indexes of granulosa and theca cells in the follicles were estimated at all stages of folliculogenesis. The number, volume and the volume density of FSH- and LH-immunoreactive cells decreased after chronic SRIH-14 treatment, particularly the latter. In the ovary, SRIH-14 treatment decreased the number of healthy follicles at all phases of folliculogenesis, lowered the mitotic indexes of granulosa and theca cells but increased the number of atretic follicles. Healthy CL were fewer in number, while regressive CL were increased. Vaginal opening occurred at a later age in treated females. It can be concluded that chronic SRIH-14 treatment markedly inhibited LH cells and to a lesser extent FSH cells. In the ovary SRIH-14 inhibited folliculogenesis, enhanced atretic processes and lowered proliferative activity of granulosa and theca cells. It also delayed puberty onset.     

Comparative study of the antimutagenic potential of Vitamin E in different E. coli strains

The antimutagenic potential of Vitamin E due to its antioxidative properties was studied. The new Escherichia coli K12 assay-system designed in our laboratory was employed in order to detect the antimutagenic potential of Vitamin E and to determine its molecular mechanisms of action. The assay is composed of three tests. In Test A, we examine the influence of the antioxidant on induced oxidative mutagenesis in a repair-proficient strain. Spontaneous mutagenesis is monitored in Test B, which is performed with two mutator strains, one mismatch repair-deficient (mutS) and another deficient in 8-oxo-dGTP-ase activity (mutT). In Test M, a repair-proficient strain and its mismatch repair-deficient counterpart (mutH), both carrying a plasmid with microsatellite sequences, are used to measure the level of microsatellite instability. To examine the antimutagenic potential of Vitamin E we also used the WP2 antimutagenicity test. Protective properties of Vitamin E against oxidative mutagenesis were detected in all tests with the E. coli K12 assay-system as well as in the WP2 antimutagenicity test. This study confirms that mismatch repair is essential for repair of oxidative DNA damage. The results obtained indicate that Vitamin E prevents the formation of DNA adducts by lipid peroxidation products rather than those formed by direct oxidation of DNA bases. Moreover, it can reduce microsatellite instability. After further validation, the new E. coli K12 assay-system can be used to test the antimutagenic potential of antioxidants.     

Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.     

ALIS are stress-induced protein storage compartments for substrates of the proteasome and autophagy

Misfolded proteins can be directed into cytoplasmic aggregates such as aggresomes and dendritic cell aggresome-like induced structures (DALIS). DALIS were originally identified in lipopolysaccharide-stimulated dendritic cells and act as storage compartments for polyubiquitinated Defective Ribosomal Products (DRiPs) prior to their clearance by the proteasome. Here we demonstrate that ubiquitinated protein aggregates that are similar to DALIS, and not related to aggresomes, can be observed in several cell types in response to stress, including oxidative stress, transfection, and starvation. Significantly, both immune and nonimmune cells could form these aggresome-like induced structures (ALIS). Protein synthesis was essential for ALIS formation in response to oxidative stress, indicating that DRiP formation was required. Furthermore, puromycin, which increases DRiP formation, was sufficient to induce ALIS formation. Inhibition of either proteasomes or of autophagy interfered with ALIS clearance in puromycin treated cells. Autophagy inhibition enhanced ALIS formation under a variety of stress conditions. During starvation, ALIS formation in autophagy-deficient cells was only partially inhibited by protein synthesis inhibitors, indicating that both long-lived proteins and DRiPs can be targeted to ALIS. Together, these findings demonstrate that ALIS act as generalized stress-induced protein storage compartments for substrates of the proteasome and autophagy.     

Optimization and validation of the direct HPLC method for the determination of moxifloxacin in plasma

Moxifloxacin (1-cyclopropyl-6-fluoro-1,4-dihydro-8-methoxy-7-[(4aS,7aS)-octahydro-6H-pyrrolo-[3,4-b]pyridin-6-yl]-4-oxo-3-quinolinecarboxylic acid hydrochloride) is new, fourth generation fluoroquinolone with broaden spectrum of antibacterial activity. In the present work simple and rapid RP-HPLC method for the direct determination of moxifloxacin in human plasma is described. Separation of moxifloxacin from plasma components was achieved on Supelco LC-Hisep shielded hydrophobic phase column. The mobile phase consisted of acetonitrile and 0.25mol/dm(3) Na(3)PO(4) (pH 3) in a volume percent ratio (5:95, v/v) and was delivered at a rate of 1mL/min. Fluorescence detection was employed with excitation at 290nm and emission at 500nm. Ofloxacin was used as internal standard and sodium dodecylsulfate solution was used as a displacing agent. Sample preparation was simplified and involved only addition of displacing agent and internal standard and dilution with water. The separation conditions were optimized by the response surface method in two factor space, i.e. the dependence of the retention time on volume percent of acetonitrile and on pH of aqueous phase was optimized. The method was fully validated and validation parameters were: linearity range 3-1300microg/L; correlation coefficient, 0.99986; mean recovery, 92.5%; limit of quantification, 3.0microg/L and limit of detection, 1.0microg/L. Method was applied for the determination of moxifloxacin in human plasma after single or repeated oral doses of 400mg Avelox tablets. The proposed method proved to be rapid and accurate and can be successfully used in pharmacokinetic studies and routine clinical practice.     

First record of the raccoon dog (Nyctereutes procyonoides Gray, 1834) in the former Yugoslav Republic of Macedonia

An adult male raccoon dog (Nyctereutes procyonoides Gray, 1834) run over by a car was found on September 6, 2002, in the central part of the Former Yugoslav Republic of Macedonia (UTM: EM 54). This is the first record of this species on the territory of the FYRM, and the southernmost point of its European range so far. This finding indicates a range extension of the raccoon dog on the Balkan Peninsula.