Chemical modification of santonin into a diacetoxy acetal form confers the ability to induce differentiation of human promyelocytic leukemia cells via the down-regulation of NF-kappaB DNA binding activity

Many sesquiterpene lactone compounds either induce or enhance the cell differentiation of human leukemia cells. However, we reported in a previous study that santonin, a eudesmanolide sesquiterpene lactone, exerts no effects on the differentiation of leukemia cells. In this report, to evaluate the possibility of chemically modifying santonin into its derivatives with differentiation inducing activity, we synthesized a series of santonin derivatives, and determined their effects on cellular differentiation in the human promyelocytic leukemia HL-60 cell system. A diacetoxy acetal derivative of santonin (DAAS) was found to induce significant HL-60 cell differentiation in a dose-dependent manner, whereas santonin in its original form did not. The HL-60 cells were differentiated into a granulocytic lineage when exposed to DAAS. In addition, the observed induction in cell differentiation closely correlated with the levels of NF-kappaB DNA binding activity inhibited by DAAS. Both Western blot analyses and kinase inhibitor studies determined that protein kinase C, ERK, and phosphatidylinositol 3-kinase were upstream components of the DAAS-mediated inhibition of NF-kappaB binding activity in HL-60 leukemia cells. The results of this study indicate that santonin can, indeed, be chemically modified into a derivative with differentiation inducing abilities, and suggest that DAAS might prove useful in the treatment of neoplastic diseases.     

uPAR expression under hypoxic conditions depends on iNOS modulated ERK phosphorylation in the MDA-MB-231 breast carcinoma cell line

Urokinase plasminogen activator receptor （uPAR） plays a major role in cancer-invasion and metastasis and uPAR expression is correlated with a poor prognosis in various cancer types. Moreover, the expression of uPAR is increased under hypoxic conditions. Nitric oxide （NO） and its metabolites produced by inducible nitric oxide synthase （iNOS） are important products ofhypoxic stress, and NO may activate or modulate extracellular signal regulated kinase （ERK）. Here, we evaluated uPA, uPAR, and activated ERK levels under hypoxic conditions, and the modulatory effects of iNOS and NO in the MDA-MB-231 human breast cancer cell line. Cells were incubated in a hypoxic or normoxic incubator and treated with PD98059 （a MEK 1/2 inhibitor, which abrogates ERK phosphorylation） and aminoguanidine （a selective iNOS inhibitor）, uPAR expression, ERK phosphorylation, and uPA activity were found to be increased under hypoxic conditions. Moreover, when cells were treated with PD98059 under hypoxic conditions, uPAR was downregulated, whereas aminoguanidine markedly increased ERK phosphorylation in a dose dependent manner. Furthermore, aminoguanidine increased uPAR expression and prevented the inhibition of uPAR expression by PD98059. These results demonstrated that uPAR is induced by hypoxia and that increased uPAR expression is mediated by ERK phosphorylation, which in turn is modulated by iNOS/NO in MDA-MB-231 cells. We conclude that iNOS/NO downregulates the expression of uPAR under hypoxic conditions via ERK pathway modulation.     

Deconvoluting post-transplant immunity: cell subset-specific mapping reveals pathways for activation and expansion of memory T, monocytes and B cells

A major challenge for the field of transplantation is the lack of understanding of genomic and molecular drivers of early post-transplant immunity. The early immune response creates a complex milieu that determines the course of ensuing immune events and the ultimate outcome of the transplant. The objective of the current study was to mechanistically deconvolute the early immune response by purifying and profiling the constituent cell subsets of the peripheral blood. We employed genome-wide profiling of whole blood and purified CD4, CD8, B cells and monocytes in tandem with high-throughput laser-scanning cytometry in 10 kidney transplants sampled serially pre-transplant, 1, 2, 4, 8 and 12 weeks. Cytometry confirmed early cell subset depletion by antibody induction and immunosuppression. Multiple markers revealed the activation and proliferative expansion of CD45RO(+)CD62L(-) effector memory CD4/CD8 T cells as well as progressive activation of monocytes and B cells. Next, we mechanistically deconvoluted early post-transplant immunity by serial monitoring of whole blood using DNA microarrays. Parallel analysis of cell subset-specific gene expression revealed a unique spectrum of time-dependent changes and functional pathways. Gene expression profiling results were validated with 157 different probesets matching all 65 antigens detected by cytometry. Thus, serial blood cell monitoring reflects the profound changes in blood cell composition and immune activation early post-transplant. Each cell subset reveals distinct pathways and functional programs. These changes illuminate a complex, early phase of immunity and inflammation that includes activation and proliferative expansion of the memory effector and regulatory cells that may determine the phenotype and outcome of the kidney transplant.     

Improving thermal hysteresis activity of antifreeze protein from recombinant Pichia pastoris by removal of N-glycosylation

To survive in a subzero environment, polar organisms produce ice-binding proteins (IBPs). These IBPs prevent the formation of large intracellular ice crystals, which may be fatal to the organism. Recently, a recombinant FfIBP (an IBP from Flavobacterium frigoris PS1) was cloned and produced in Pichia pastoris using fed-batch fermentation with methanol feeding. In this study, we demonstrate that FfIBP produced by P. pastoris has a glycosylation site, which diminishes the thermal hysteresis activity of FfIBP. The FfIBP expressed by P. pastoris exhibited a doublet on SDS-PAGE. The results of a glycosidase reaction suggested that FfIBP possesses complex N-linked oligosaccharides. These results indicate that the residues of the glycosylated site could disturb the binding of FfIBP to ice molecules. The findings of this study could be utilized to produce highly active antifreeze proteins on a large scale.     

Potential application of genetically identical somatic cell nuclear transfer-cloned dogs for gastrointestinal microbiota analysis

This study investigated the gastrointestinal microbiota in three genetically identical cloned dogs (A, B and C) by somatic cell nuclear transfer. We collected feces from three cloned dogs and their feed to investigate gastrointestinal microbiota using both culture-dependent and culture-independent methods. A total of 962 strains from the feces of cloned dogs were isolated using aerobic and anaerobic culture methods. The dominant microorganisms were Enterococcus faecalis and Enterococcus faecium in all fecal samples. In particular, the fecal sample from cloned dog C had similar proportions of three species (E. faecalis, E. faecium and Lactobacillus murinus). In all, 29 DNA fragments were identified by PCR-denaturing gradient gel electrophoresis (DGGE) analysis. The highest DGGE band intensities were for E. faecalis from cloned dogs A and C and for Clostridium sordellii from cloned dog B, with relative intensities of 15.2, 17.7 and 14.4%, respectively. The other strains identified from the cloned dogs were Chryseobacterium soldanellicola, Escherichia coli, L. murinus, Streptococcus alactolyticus, Weissella confusa and uncultured bacterium. Some microbes isolated from the fecal samples, including C. soldanellicola and W. confuse, were derived from the feed. Overall, gastrointestinal microbiota of all genetically identical cloned dogs, maintained under the same environmental and feeding conditions, showed similar profiles in terms of species diversity analyzed by PCR-DGGE, although there were proportional differences in the amounts of bacterial species. To our knowledge, this is the first report to investigate and compare gastrointestinal microbiota of three genetically identical dogs.     

Rapid MALDI biotyper-based identification and cluster analysis of <Emphasis Type="Italic">Streptococcus iniae</Emphasis>

Streptococcus iniae causes severe mortalities among cultured marine species, especially in the olive flounder (Paralichthys olivaceus), which is economically important in Korea and Japan. Recently, there has been growing concern regarding the emergence of S. iniae as a zoonotic pathogen. Here, 89 S. iniae isolates obtained from diseased olive flounders collected from 2003 to 2008 in Jeju Island, South Korea, were characterized using matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS). The results were aligned both with the available Bruker Daltonics data-base and with a new set of S. iniae data entries developed in our laboratory, and the results were compared. When we used the Bruker Daltonics database, the 89 isolates yielded either “no reliable identification” or were incorrectly identified as Streptococcus pyogenes at the genus level. When we used the new data entries from our laboratory, in contrast, all of the isolates were correctly identified as S. iniae at the genus (100%) and species (96.6%) levels. We performed proteomic analysis, divided the 89 isolates into cluster I (51.7%), cluster II (20.2%), and cluster III (28.1%), and then used the MALDI Biotyper software to identify specific mass peaks that enabled discrimination between clusters and between Streptococcus species. Our results suggest that the use of MALDI TOF MS could outperform the conventional methods, proving easier, faster, cheaper and more efficient in properly identifying S. iniae. This strategy could facilitate the epidemiological and taxonomical study of this important fish pathogen.     

Assessment of organic removal in series- and parallel-connected microbial fuel cell stacks

Microbial fuel cells (MFCs) degrade organic contaminants in wastewater while simultaneously producing electricity, but must be stacked to yield adequate voltage and current. This study examined the evolution of the chemical oxygen demand (COD) removal rate and efficiency in two identical individual MFCs (i-MFCs) in series- and parallel-connected stacks (sc- and pc-MFCs, respectively) under batch and continuous operation. The stack voltage and current increased in the respective series and parallel connections of the two i-MFCs (MFC unit 1 and MFC unit 2). Voltage reversal was observed in the sc- MFC below an external load of 100 Ω. Regardless of occurrence of the voltage reversal, organic reduction between i-MFCs and sc-MFCs showed no significant difference (gap of < 9% and < 6% in COD removal rate and efficiency, respectively); additionally, organic removals between the two individual MFCs in series indicated differences less than 9% of COD removal rate and 5% of COD removal efficiency in batch mode. Continuous operation also yielded similar organic removals as the MFCs in individual and series connection (voltage reversal occurred) mode, even over 8 days operation. Parallel connection yielded identical organic removals and currents in the two individual MFCs of the pc-MFC, even though the two separate i-MFCs showed different organic removal rates and current productions. This study provides the guide for the application of stacked MFCs for power source and efficient organic pollutant removal in wastewater treatment process.     

Annexin A1 restores Aβ1‐42‐induced blood–brain barrier disruption through the inhibition of RhoA‐ROCK signaling pathway

The blood–brain barrier (BBB) is composed of brain capillary endothelial cells and has an important role in maintaining homeostasis of the brain separating the blood from the parenchyma of the central nervous system (CNS). It is widely known that disruption of the BBB occurs in various neurodegenerative diseases, including Alzheimer's disease (AD). Annexin A1 (ANXA1), an anti‐inflammatory messenger, is expressed in brain endothelial cells and regulates the BBB integrity. However, its role and mechanism for protecting BBB in AD have not been identified. We found that β‐Amyloid 1‐42 (Aβ42)‐induced BBB disruption was rescued by human recombinant ANXA1 (hrANXA1) in the murine brain endothelial cell line bEnd.3. Also, ANXA1 was decreased in the bEnd.3 cells, the capillaries of 5XFAD mice, and the human serum of patients with AD. To find out the mechanism by which ANXA1 recovers the BBB integrity in AD, the RhoA‐ROCK signaling pathway was examined in both Aβ42‐treated bEnd.3 cells and the capillaries of 5XFAD mice as RhoA was activated in both cases. RhoA inhibitors alleviated Aβ42‐induced BBB disruption and constitutively overexpressed RhoA‐GTP (active form of RhoA) attenuated the protective effect of ANXA1. When pericytes were cocultured with bEnd.3 cells, Aβ42‐induced RhoA activation of bEnd.3 cells was inhibited by the secretion of ANXA1 from pericytes. Taken together, our results suggest that ANXA1 restores Aβ42‐induced BBB disruption through inhibition of RhoA‐ROCK signaling pathway and we propose ANXA1 as a therapeutic reagent, protecting against the breakdown of the BBB in AD.     

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K_d [kanamycin] = 78.8 nM, K_d [kanamycin B] = 84.5 nM, and K_d [tobramycin] = 103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.