Recombinant bovine herpesvirus-1 expressing p23 protein of Cryptosporidium parvum induces neutralizing antibodies in rabbits

In order to develop a vaccine against cryptosporidiosis in cattle, we constructed a recombinant bovine herpesvirus-1 (BHV-1) expressing an immunodominant surface protein, p23, of Cryptosporidium parvum sporozoites. In the recombinant virus, the p23 gene under the control of a CAG promoter and a gene coding for an enhanced green fluorescent protein were integrated into the gG gene of BHV-1. Despite a low frequency of homologous recombination, cloning of the recombinants was easy because of the specific fluorescence of the plaques formed by recombinants. These plaques were among the plaques of the nonfluorescent parental virus. All clones selected for fluorescence also contained the p23 gene. In MDBK cells infected with the recombinant BHV-1, the antibody against the p23 protein recognized the p23 protein as an approximately 23-kDa specific band in Western blotting analysis. Rabbits immunized with the recombinant produced IgG against the p23 protein. It was also demonstrated that the sera of immunized rabbits reduced infection of C. parvum sporozoites in HCT-8 cells. The serum of an immunized rabbit reduced infection compared with the normal rabbit serum control. These results indicate that the recombinant BHV-1 induces neutralizing antibodies in rabbits.     

Effects of different beta73 amino acids on formation of 14-stranded fibers of Hb S versus double-stranded crystals of Hb C-Harlem

Hb S (alpha(2)beta(2)(6Glu-->Val)) forms polymers, while Hb C-Harlem (alpha(2)beta(2)(6Glu-->Val,73Asp-->Asn)) forms crystals upon oversaturation. Since the only difference between the two is the beta73 amino acid, it follows that this site is a critical determinant in promoting either polymerization or crystallization. Beta73 Asp in Hb S forms a hydrogen bond with beta4 Thr, while beta73 Asn in Hb C-Harlem may inhibit this interaction as well as increase the hydrophobicity at the EF helix beta6 Val acceptor sites. Two new beta73 Hb S variants (beta73 His and Leu) were constructed and analyzed to define other amino acids facilitating formation of Hb S-like polymers versus Hb C-Harlem-like crystals. The two variants that were chosen were expected to either (1) enhance formation of the beta73-beta4 hydrogen bond (beta73 His) or (2) inhibit it and increase the hydrophobicity of the EF helix beta6 Val acceptor sites (beta73 Leu). beta73 His Hb S formed fibers but at a lower concentration than Hb S, while beta73 Leu Hb S formed crystals but at a higher concentration than Hb C-Harlem. The solubility of beta73 His Hb S was (1)/(7) of that of Hb S, while the solubility of beta73 Leu Hb S was similar to that of Hb C-Harlem. The delay time prior to polymer or crystal formation depended on Hb concentration. The delay time for beta73 His Hb S was 10(5)-fold shorter than that for Hb S, while that for beta73 Leu Hb S was 10(5)-fold longer in 1.0 M phosphate buffer. NMR results indicate beta73 amino acid changes induce alteration in the beta-chain heme pocket region, while CD results indicate no change in the helical content of the variants. These results suggest that enhancing the beta73-beta4 hydrogen bond and/or induced changes in the heme pocket by the beta73 Asp to His change facilitate formation of Hb S-like fibers. Our results also suggest that removal of the beta73-beta4 hydrogen bond and enhancing the hydrophobicity of the EF helix beta6 Val acceptor sites by the beta73 Asp to Leu or Asn changes delay nuclei formation and facilitate formation of Hb C-Harlem-like crystals.     

CD36-mediated endocytic uptake of advanced glycation end products (AGE) in mouse 3T3-L1 and human subcutaneous adipocytes

Interaction of advanced glycation end products (AGE) with AGE receptors induces several cellular phenomena potentially relating to diabetic complications. We here show that AGE-modified bovine serum albumin (BSA) is endocytosed by adipocytes via CD36. Upon differentiation, 3T3-L1 and human subcutaneous adipose cells showed marked increases in endocytic uptake and subsequent degradation of [(125)I]AGE-BSA, which were inhibited effectively by the anti-CD36 antibody. Ligand specificity of CD36 for modified BSAs was compared with that of LOX-1 and scavenger receptor class A. Effect of fucoidan on [(125)I]AGE-BSA binding showed a sharp contrast to that on [(125)I]-oxidized low density lipoprotein. These results implicate that CD36-mediated interaction of AGE-modified proteins with adipocytes might play a pathological role in obesity or insulin-resistance.     

Kinetic analysis of microbial desulfurization of model and light gas oils containing multiple alkyl dibenzothiophenes

The reaction mechanism of biodesulfurization was investigated using whole cells of Rhodococcus erythropolis KA2-5-1, which have the ability to convert dibenzothiophene (DBT) into 2-hydroxybiphenyl. The desulfurization patterns of alkyl DBTs were represented by the Michaeis-Menten equation. The values of rate constants, the limiting maximal velocity (Vmax) and Michaelis constant (Km), for desulfurization of alkyl DBTs were calculated. The relative desulfurization activities of various alkyl DBTs were reduced in proportion to the total carbon numbers of alkyl substituent groups. Alkyl DBTs that had a total of six carbons of alkyl substituent groups were not desulfurized. The type or position of alkyl substituent groups had little effect on desulfurization activity. The desulfurization activity of each alkyl DBT, when mixed together, was reduced. This phenomenon was caused by apparent competitive inhibition of substrates. Using the apparent competitive inhibition model, the desulfurization pattern of a multiple components system containing alkyl DBTs was elucidated. This model was also applicable for biodesulfurization of light gas oil.     

Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.     

Peroxisomes of the nematode Caenorhabditis elegans: distribution and morphological characteristics

We analyzed the distribution and morphological characteristics of peroxisomes in the nematode Caenorhabditis elegans by routine electron microscopy, immunoelectron microscopy, and morphometry. Peroxisomes were mainly contained in the epithelial cells of the digestive tract and pharyngeal gland, but some were observed in other cells. Their shape varied from round to twisted. The matrix of most peroxisomes was coarse and uneven, and contained electron-dense nucleoids and frequently tubular substructures. The diameter of peroxisomes in the gut (0.185 micro m) was smaller than that in pharyngeal gland (0.262 micro m). The volume density of peroxisomes per 100 micro m(2) of cytoplasm was 1.86 in the gut and 1.75 in the pharyngeal gland. After treatment with clofibrate, the diameter of peroxisomes increased approximately 1.11-fold in the gut and 1.2-fold in the pharyngeal gland. The volume density of peroxisomes also increased by 2.2-fold in the gut and 2.6-fold in the pharyngeal gland. The labeling density for catalase-2 was almost identical between gut and pharyngeal gland peroxisomes. The results show that in C. elegans peroxisomes mainly distribute in the epithelial cells of the gut and pharyngeal gland. Peroxisomes of the pharyngeal gland are larger than those of the gut, but peroxisomes of both tissues contain catalase-2 at similar concentrations.