32P uptake in three submerged aquatic plant species

Summary Highest uptake of³²P by young shoots of three plant species was observed and lowest by old ones. The uptake of³²P was highest inHydrilla shoots, followed byVallisneria andPotamogeton.Kinetin (0.23 mM) pretreatment (24 h) increased the uptake of³²P, while 0.69 mM ethrel or 0.075 mM ABA decreased it in all species.³²P was transported to the largest extent to the young shoots of the submerged plants and to the smallest extent to the old ones by kinetin pretreatment. Kinetin enhanced the uptake of³²P most inHydrilla shoots, followed byVallisneria andPotamogeton. Ethrel diminished³²P uptake most inPotamogeton shoots and to the smallest extent inHydrilla, while ABA lowered it most inHydrilla shoots and to the smallest extent inPotamogeton. Kinetin, ethrel and ABA can modify the uptake of³²P of these aquatic plants.     

Partial purification of a ribonucleic acid cAMP-independent protein kinase from embryonic chicken muscle

A cAMP-indepedent protein kinase (P38 kinase) from embryonic chicken muscle with ability to phosphorylate a 38,000 molecular weight polypeptide and to bind to RNAs has been further characterized. An approximately 2000-fold purification of this enzyme was achieved by a combination of affinity and ion-exchange chromatography. Our studies indicate that this protein kinase can not phosphorylate the small subunit of rabbit reticulocyte initiation factor eIF-2 in the presence of its normal endogenous substrate, nor is it activated over a wide range of concentrations of double-stranded RNA. This P38 kinase is, therefore, distinct from the hemin-regulated translational inhibitor of protein synthesis in rabbit reticulocytes and from the interferon-induced protein kinase identified In several systems.     

Highly solvatochromic fluorescent naphthalimides: Design,synthesis, photophysical properties and fluorescence switch-on sensing of ct-DNA

We report the design, synthesis and photophysical properties of highly solvatochromic donor/acceptor substituted naphthalimide based fluorophores. The synthesized naphthalimides containing propargyl ends showed highly solvatochromic intramolecular charge transfer (ICT) feature as was revealed from the UV–visible, fluorescence photophysical properties of these fluorophores and DFT/TDDFT calculation. Fluorescence life times for the imide fluorophores were also measured in different solvents. The solid state photophysical property of donor substituted naphthalimide 1 showed promising for future application in material sciences. Furthermore, both the donor/acceptor substituted naphthalimide fluorophores 1–2 were exploited in sensing calf-thymus DNA via switch-on fluorescence response. The propargyl linker containing naphthalimides can further be exploited for the synthesis of labeled biomolecular building blocks.     

Temperature dependence of diffusion in model and live cell membranes characterized by imaging fluorescence correlation spectroscopy

The organization of the plasma membrane is regulated by the dynamic equilibrium between the liquid ordered (L_o) and liquid disordered (L_d) phases. The abundance of the L_o phase is assumed to be a consequence of the interaction between cholesterol and the other lipids, which are otherwise in either the L_d or gel (S_o) phase. The characteristic lipid packing in these phases results in significant differences in their respective lateral dynamics. In this study, imaging total internal reflection fluorescence correlation spectroscopy (ITIR-FCS) is applied to monitor the diffusion within supported lipid bilayers (SLBs) as functions of temperature and composition. We show that the temperature dependence of membrane lateral diffusion, which is parameterized by the Arrhenius activation energy (E_Arr), can resolve the sub-resolution phase behavior of lipid mixtures. The FCS diffusion law, a novel membrane heterogeneity ruler implemented in ITIR-FCS, is applied to show that the domains in the S_o–L_d phase are static and large while they are small and dynamic in the L_o–L_d phase. Diffusion measurements and the subsequent FCS diffusion law analyses at different temperatures show that the modulation in membrane dynamics at high temperature (313 K) is a cumulative effect of domain melting and rigidity relaxation. Finally, we extend these studies to the plasma membranes of commonly used neuroblastoma, HeLa and fibroblast cells. The temperature dependence of membrane dynamics for neuroblastoma cells is significantly different from that of HeLa or fibroblast cells as the different cell types exhibit a high level of compositional heterogeneity.     

IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain

Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregulatory sequence (ARS) located at the 5' untranslated region of the PABP-mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nM and 5.9 nM, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3' end of the ARS. Results of our analysis suggest that both protein x protein and protein x RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA.     

Seasonal plankton dynamics along a cross-shelf gradient

Much interest has recently been devoted to reconstructing the dynamic structure of ecological systems on the basis of time-series data. Using 10 years of monthly data on phyto- and zooplankton abundance from the Bay of Biscay (coastal to shelf-break sites), we demonstrate that the interaction between these two plankton components is approximately linear, whereas the effects of environmental factors (nutrients, temperature, upwelling and photoperiod) on these two plankton population growth rates are nonlinear. With the inclusion of the environmental factors, the main observed seasonal and inter-annual dynamic patterns within the studied plankton assemblage also indicate the prevalence of bottom-up regulatory control.     

Intelligent fluorescent nucleoside in sensing cytosine base: importance of hydrophobic nature of perylene fluorophore

Fluorescence response upon hybridization of perylene labeled oligonucleotide probes depends on the microenvironment experienced by the perylene fluorophore. In mismatched duplex (^PerU-C), enhanced fluorescence was observed while in matched duplex (^PerU-A) fluorescence intensity decreased considerably. This observation will be a promising research effort in giving rise to a new powerful tool in detection of SNP.     

Design,synthesis, biological evaluation and computational investigation of novel inhibitors of dihydrofolate reductase of opportunistic pathogens

The present work deals with design, synthesis and biological evaluation of novel, diverse compounds as potential inhibitors of dihydrofolate reductase (DHFR) from opportunistic microorganisms; Pneumocystis carinii (pc), Toxoplasma gondii (tg) and Mycobacterium avium (ma). A set of 14 structurally diverse compounds were designed with varying key pharmacophoric features of DHFR inhibitors, bulky distal substitutions and different bridges joining the distal part and 2,4-diaminopyrimidine nucleus. The designed compounds were synthesized and evaluated in enzyme assay against pc, tg and ma DHFR. The rat liver (rl) DHFR was used as mammalian standard. As the next logical step of the project, flexible molecular docking studies were carried out to predict the binding modes of these compounds in pcDHFR active site and the obtained docked poses were post processed using MM-GBSA protocol for prediction of relative binding affinity. The predicted binding modes were able to rationalize the experimental results in most cases. Of particular interest, both the docking scores and MM-GBSA predicted ΔG_bind were able to distinguish between the active and low active compounds. Furthermore, good correlation coefficient of 0.797 was obtained between the IC₅₀ values and MM-GBSA predicted ΔG_bind. Taken together, the current work provides not only a novel scaffold for further optimization of DHFR inhibitors but also an understanding of the specific interactions of inhibitors with DHFR and structural modifications that improve selectivity.