Length–weight relationships of three freshwater fish species from Rupnaryan and Kangsabati River,West Bengal,India

The length–weight relationships (LWRs) of three freshwater fish species from the Kangsabati and Rupnaryan river in West Bengal, India are presented, namely as Amblypharyngodon microlepis (Bleeker, 1853), Parambassis lala (Hamilton, 1822) and Macrognathus aculeatus (Bloch, 1786). Gill‐nets (mesh sizes with 0.5 cm–4 cm), cast‐nets (up to 1 × 1 cm mesh size with up to 4.0 m² area) and scoop‐nets (0.3 × 0.3 cm and 0.5 × 0.5 cm mesh size) were used from January, 2017 to April, 2018. Sampling was done every 15 days during this period. The value of parameter “b” ranged from 2.751 to 2.895 with highly significant correlations (r² > 0.95).     

Survival of orally administered isolated intestinalLactobacillus acidophilus in different parts of gastrointestinal tract of mice

A strain ofLactobacillus acidophilus (Strain HF) was isolated from human faeces. A chloramphenicol resistant strain (HFCm) and a strain (HFCmSm) restant to both chloramphenicol and streptomycin were developed from the isolated strain (HF). All the three strains showed similarin vitro susceptibility against host defence factors like gastric acid, bile salts and volatile as well as non-volatile fatty acids.In vivo tests were done by feeding these strains to mice. When the resistant strains were orally administered along with the antibiotic(s) they were stable up to 72 h     

Changes in endogenous indole-3-acetic acid and some biochemical parameters during seed development in <Emphasis Type="Italic">Camellia sinensis</Emphasis> (L.) O. Kuntze

The role of endogenous indole-3-acetic acid (IAA), soluble proteins and RNA in the development of tea (Camellia sinensis (L). O. Kuntze) seeds was investigated in the present study. The state of continuum even at full maturity and lack of a clear end point to seed development as indicated by the persistence of appreciable contents of proteins at full maturity in all the seed parts further confirmed the ‘recalcitrant nature’ of the tea seeds. Unlike the orthodox seeds, the level of free IAA in tea embryos also remained high even at full maturity. The total RNA content remained high in the stages with high moisture content but declined with progressive decline in moisture content.     

Endogenous ocular lipids as potential modulators of intraocular pressure

Elevated intraocular pressure (IOP) is a risk factor in glaucoma, a group of irreversible blinding diseases. Endogenous lipids may be involved in regulation of IOP homeostasis. We present comparative fold analysis of phospholipids and sphingolipids of aqueous humour and trabecular meshwork from human control vs primary open-angle glaucoma and mouse control (normotensive) vs ocular hypertensive state. The fold analysis in control vs disease state was based on ratiometric mass spectrometric data for above classes of lipids. We standardized in vitro assays for rapid characterization of lipids undergoing significant diminishment in disease state. Evaluation of lipids using in vitro assays helped select a finite number of lipids that may potentially expand cellular interstitial space embedded in an artificial matrix or increase fluid flow across a layer of cells. These assays reduced a number of lipids for initial evaluation using a mouse model, DBA/2J with spontaneous IOP elevation. These lipids were then used in other mouse models for confirmation of IOP lowering potential of a few lipids that were found promising in previous assessments. Our results provide selected lipid molecules that can be pursued for further evaluation and studies that may provide insight into their function.     

Bacopasaponins with cytotoxic activity against human breast cancer cells in vitro

Molecular Biology Reports - Globally, breast cancer is a serious concern that exhibits a persistent rise in its incidence and related mortality even after significant advancement in the field of...     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

Smokeless Tobacco Extract (STE)-Induced Toxicity in Mammalian Cells is Mediated by the Disruption of Cellular Microtubule Network: A Key Mechanism of Cytotoxicity

Smokeless tobacco usage is a growing public health problem worldwide. The molecular mechanism(s) underlying smokeless tobacco associated tissue damage remain largely unidentified. In the present study we have tried to explore the effects of aqueous extract of smokeless tobacco (STE) on tubulin-microtubule, the major cytoskeleton protein that maintains cells morphology and participates in cell division. Exposure to STE resulted in dose-dependent cytotoxicity in a variety of mammalian transformed cell lines such as human lung epithelial cells A549, human liver epithelial cells HepG2, and mouse squamous epithelial cells HCC7, as well as non-tumorogenic human peripheral blood mononuclear cells PBMC. Cellular morphology of STE-treated cells was altered and the associated disruption of microtubule network indicates that STE targets tubulin-microtubule system in both cell lines. Furthermore it was also observed that STE-treatment resulted in the selective degradation of cellular tubulin, whereas actin remains unaltered. In vitro, polymerization of purified tubulin was inhibited by STE with the IC₅₀ value∼150 µg/ml and this is associated with the loss of reactive cysteine residues of tubulin. Application of thiol-based antioxidant N-acetyl cysteine (NAC) significantly abrogates STE-mediated microtubule damage and associated cytotoxicity in both A549 and HepG2 cells. These results suggest that microtubule damage is one of the key mechanisms of STE-induced cytotoxity in mammalian cells.