Characterization of Solanum tuberosum Multicystatin and the Significance of Core Domains

Potato (Solanum tuberosum) multicystatin (PMC) is a unique cystatin composed of eight repeating units, each capable of inhibiting cysteine proteases. PMC is a composite of several cystatins linked by trypsin-sensitive (serine protease) domains and undergoes transitions between soluble and crystalline forms. However, the significance and the regulatory mechanism or mechanisms governing these transitions are not clearly established. Here, we report the 2.2-Å crystal structure of the trypsin-resistant PMC core consisting of the fifth, sixth, and seventh domains. The observed interdomain interaction explains PMC’s resistance to trypsin and pH-dependent solubility/aggregation. Under acidic pH, weakening of the interdomain interactions exposes individual domains, resulting in not only depolymerization of the crystalline form but also exposure of cystatin domains for inhibition of cysteine proteases. This in turn allows serine protease–mediated fragmentation of PMC, producing ∼10-kD domains with intact inhibitory capacity and faster diffusion, thus enhancing PMC’s inhibitory ability toward cysteine proteases. The crystal structure, light-scattering experiments, isothermal titration calorimetry, and site-directed mutagenesis confirmed the critical role of pH and N-terminal residues in these dynamic transitions between monomer/polymer of PMC. Our data support a notion that the pH-dependent structural regulation of PMC has defense-related implications in tuber physiology via its ability to regulate protein catabolism.     

Isolation of Messenger Ribonucleic Acid for Myosin Heavy Chain

A chicken embryonic polysome fraction that contains 50–60 monoribosomes and synthesizes the heavy chains of myosin is separated from other polysomes of smaller sizes by centrifugation through two cycles of discontinuous and continuous sucrose gradients. The unique properties of the polyadenylic acid segment present at the 3′-end of eukaryotic messenger RNA (mRNA) were used to purify the mRNA for myosin heavy chain from the phenol-extracted total RNA obtained from this polysome fraction. The total RNA was filtered thro ugh millipore filters resulting in partition of the riboscmal RNA (rRNA) and mRNA species. This millipore-bound RNA fraction, which consists of the mRNA and some ribosomal RNAs, was eluted from the filters with sodium dodecyl sulfate (SDS). Subsequent chromatography of this fraction on a cellulose column gave two well-separated peaks: an unadsorbed peak of ribosomal RNAs which was eluted with buffers of high ionic strength and an adsorbed peak of mRNA which was eluted only with a buffer of low ionic strength. Polyacrylamide gel electrophoresis of the mRNA peak fraction showed a single band with no detectable amounts of other RNAs, the mRNA migrating slower than 28S rRNA. The product of in vitro translation of the purified mRNA using a homologous cell-free system was identified as the myosin heavy chain by the following criteria: coprecipitation with carrier myosin at low ionic strength; elution properties on DEAE-cellulose column; and comigration with the heavy chain in polyacrylamide gel electrophoresis. In order to demonstrate the fidelity of translation of the mRNA, ¹⁴C-labeled products of the in vitro translation were copurified with unlabeled myosin heavy chains added as a carrier. The mixture of polypeptides was then cleaved with CNBr and the resulting peptides were separated by molecular sieving. The correlation between the radioactivity and the UV absorbance in the separated peptides indicates that total synthesis of the myosin heavy chain was achieved.     

CHEMICAL MODIFICATION OF L-ASPARAGINASE FROM Cladosporium sp. FOR IMPROVED ACTIVITY AND THERMAL STABILITY

L-Asparaginase (ASNase), an antileukemia enzyme, is facing problems with antigenicity in the blood. Modification of L-asparaginase from Cladosporium sp. was tried to obtain improved stability and improved functionality. In our experiment, modification of the enzyme was tried with bovine serum albumin, ovalbumin by crosslinking using glutaraldehyde, N-bromosuccinimide, and mono-methoxy polyethylene glycol. Modified enzymes were studied for activity, temperature stability, rate constants (k_d), and protection to proteolytic digestion. Modification with ovalbumin resulted in improved enzyme activity that was 10-fold higher compared to native enzyme, while modification with bovine serum albumin through glutaraldehyde cross-linking resulted in high stability of L-asparaginase that was 8.5- and 7.62-fold more compared to native enzyme at 28°C and 37°C by the end of 24 hr. These effects were dependent on the quantity of conjugate formed. Modification also markedly prolonged L-asparaginase half-life and serum stability. N-Bromosuccinimide-modified ASNase presented greater stability with prolonged in vitro half-life of 144 hr to proteolytic digestion relative to unmodified enzyme (93 h). The present work could be seen as producing a modified L-asparaginase with improved activity and stability and can be a potential source for developing therapeutic agents for cancer treatment.     

Proteomic profiling and functional characterization of early and late shoulder osteoarthritis

Introduction

The development of effective treatments for osteoarthritis (OA) has been hampered by a poor understanding of OA at the cellular and molecular levels. Emerging as a disease of the ''whole joint’, the importance of the biochemical contribution of various tissues, including synovium, bone and articular cartilage, has become increasingly significant. Bathing the entire joint structure, the proteomic analysis of synovial fluid (SF) from osteoarthritic shoulders offers a valuable ''snapshot’ of the biologic environment throughout disease progression. The purpose of this study was to identify differentially expressed proteins in early and late shoulder osteoarthritic SF in comparison to healthy SF.

Methods

A quantitative ¹⁸O labeling proteomic approach was employed to identify the dysregulated SF proteins in early (n = 5) and late (n = 4) OA patients compared to control individuals (n = 5). In addition, ELISA was used to quantify six pro-inflammatory and two anti-inflammatory cytokines.

Results

Key results include a greater relative abundance of proteins related to the complement system and the extracellular matrix in SF from both early and late OA. Pathway analyses suggests dysregulation of the acute phase response, liver x receptor/retinoid x receptor (LXR/RXR), complement system and coagulation pathways in both early and late OA. The network related to lipid metabolism was down-regulated in both early and late OA. Inflammatory cytokines including interleukin (IL) 6, IL 8 and IL 18 were up-regulated in early and late OA.

Conclusions

The results suggest a dysregulation of wound repair pathways in shoulder OA contributing to the presence of a ''chronic wound’ that progresses irreversibly from early to later stages of OA. Protease inhibitors were downregulated in late OA suggesting uncontrolled proteolytic activity occurring in late OA. These results contribute to the theory that protease inhibitors represent promising therapeutic agents which could limit proteolytic activity that ultimately leads to cartilage destruction.     

Oligonucleotide Conjugates: Alteration of the Pharmacokinetic Properties of Antisense Agents

Abstract

Cholic acid, cholesterol, several polyamines and polyethylene glycols were conjugated to antisense oligonucleotides targeted to human or murine intercellular adhesion molecule-1 (ICAM-1) mRNA to study their effects on cellular absorption.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

Stress-induced effects, which inhibit host defenses, alter leukocyte trafficking

Acute cold restraint stress (ACRS) has been reported to suppress host defenses against Listeria monocytogenes, and this suppression was mediated by beta1-adrenoceptors (β1-ARs). Although ACRS appears to inhibit mainly early innate immune defenses, interference with leukocyte chemotaxis and the involvement of β1-AR (or β2-AR) signaling had not been assessed. Thus, the link between sympathetic nerve stimulation, release of neurotransmitters, and changes in blood leukocyte profiles, including oxidative changes, following ACRS was evaluated. The numbers of leukocyte subsets in the blood were differentially affected by β1-ARs and β2-ARs following ACRS; CD3⁺ (CD4 and CD8) T-cells were shown to be decreased following ACRS, and the T cell lymphopenia was mediated mainly through a β2-AR mechanism, while the decrease in CD19⁺ B-cells was influenced through both β1- and β2-ARs, as assessed by pharmacological and genetic manipulations. In contrast to the ACRS-induced loss of circulating lymphocytes, the number of circulating neutrophils was increased (i.e., neutrophilia), and this neutrophilia was mediated through β1-ARs. The increase in circulating neutrophils was not due to an increase in serum chemokines promoting neutrophil emigration from the bone marrow; rather it was due to neutrophil release from the bone marrow through activation of a β1-AR pathway. There was no loss of glutathione in any of the leukocyte subsets suggesting that there was minimal oxidative stress; however, there was early production of nitric oxide and generation of some protein radicals. Premature egress of neutrophils from bone marrow is suggested to be due to norepinephrine induction of nitric oxide, which affects the early release of neutrophils from bone marrow and lessens host defenses.     

Characterizing the normal proteome of human ciliary body

Background

The ciliary body is the circumferential muscular tissue located just behind the iris in the anterior chamber of the eye. It plays a pivotal role in the production of aqueous humor, maintenance of the lens zonules and accommodation by changing the shape of the crystalline lens. The ciliary body is the major target of drugs against glaucoma as its inhibition leads to a drop in intraocular pressure. A molecular study of the ciliary body could provide a better understanding about the pathophysiological processes that occur in glaucoma. Thus far, no large-scale proteomic investigation has been reported for the human ciliary body.

Results

In this study, we have carried out an in-depth LC-MS/MS-based proteomic analysis of normal human ciliary body and have identified 2,815 proteins. We identified a number of proteins that were previously not described in the ciliary body including importin 5 (IPO5), atlastin-2 (ATL2), B-cell receptor associated protein 29 (BCAP29), basigin (BSG), calpain-1 (CAPN1), copine 6 (CPNE6), fibulin 1 (FBLN1) and galectin 1 (LGALS1). We compared the plasma proteome with the ciliary body proteome and found that the large majority of proteins in the ciliary body were also detectable in the plasma while 896 proteins were unique to the ciliary body. We also classified proteins using pathway enrichment analysis and found most of proteins associated with ubiquitin pathway, EIF2 signaling, glycolysis and gluconeogenesis.

Conclusions

More than 95% of the identified proteins have not been previously described in the ciliary body proteome. This is the largest catalogue of proteins reported thus far in the ciliary body that should provide new insights into our understanding of the factors involved in maintaining the secretion of aqueous humor. The identification of these proteins will aid in understanding various eye diseases of the anterior segment such as glaucoma and presbyopia.     

Synconset Waves and Chains: Spiking Onsets in Synchronous Populations Predict and Are Predicted by Network Structure

Synfire waves are propagating spike packets in synfire chains, which are feedforward chains embedded in random networks. Although synfire waves have proved to be effective quantification for network activity with clear relations to network structure, their utilities are largely limited to feedforward networks with low background activity. To overcome these shortcomings, we describe a novel generalisation of synfire waves, and define ‘synconset wave’ as a cascade of first spikes within a synchronisation event. Synconset waves would occur in ‘synconset chains’, which are feedforward chains embedded in possibly heavily recurrent networks with heavy background activity. We probed the utility of synconset waves using simulation of single compartment neuron network models with biophysically realistic conductances, and demonstrated that the spread of synconset waves directly follows from the network connectivity matrix and is modulated by top-down inputs and the resultant oscillations. Such synconset profiles lend intuitive insights into network organisation in terms of connection probabilities between various network regions rather than an adjacency matrix. To test this intuition, we develop a Bayesian likelihood function that quantifies the probability that an observed synfire wave was caused by a given network. Further, we demonstrate it''s utility in the inverse problem of identifying the network that caused a given synfire wave. This method was effective even in highly subsampled networks where only a small subset of neurons were accessible, thus showing it''s utility in experimental estimation of connectomes in real neuronal-networks. Together, we propose synconset chains/waves as an effective framework for understanding the impact of network structure on function, and as a step towards developing physiology-driven network identification methods. Finally, as synconset chains extend the utilities of synfire chains to arbitrary networks, we suggest utilities of our framework to several aspects of network physiology including cell assemblies, population codes, and oscillatory synchrony.