Single‐molecule tracking reveals that the nucleoid‐associated protein HU plays a dual role in maintaining proper nucleoid volume through differential interactions with chromosomal DNA

HU (Histone‐like protein from Escherichia coli strain U93) is the most conserved nucleoid‐associated protein in eubacteria, but how it impacts global chromosome organization is poorly understood. Using single‐molecule tracking, we demonstrate that HU exhibits nonspecific, weak, and transitory interactions with the chromosomal DNA. These interactions are largely mediated by three conserved, surface‐exposed lysine residues (triK), which were previously shown to be responsible for nonspecific binding to DNA. The loss of these weak, transitory interactions in a HUα(triKA) mutant results in an over‐condensed and mis‐segregated nucleoid. Mutating a conserved proline residue (P63A) in the HUα subunit, deleting the HUβ subunit, or deleting nucleoid‐associated naRNAs, each previously implicated in HU’s high‐affinity binding to kinked or cruciform DNA, leads to less dramatically altered interacting dynamics of HU compared to the HUα(triKA) mutant, but highly expanded nucleoids. Our results suggest HU plays a dual role in maintaining proper nucleoid volume through its differential interactions with chromosomal DNA. On the one hand, HU compacts the nucleoid through specific DNA structure‐binding interactions. On the other hand, it decondenses the nucleoid through many nonspecific, weak, and transitory interactions with the bulk chromosome. Such dynamic interactions may contribute to the viscoelastic properties and fluidity of the bacterial nucleoid to facilitate proper chromosome functions.     

Characterization of Solanum tuberosum Multicystatin and the Significance of Core Domains

Potato (Solanum tuberosum) multicystatin (PMC) is a unique cystatin composed of eight repeating units, each capable of inhibiting cysteine proteases. PMC is a composite of several cystatins linked by trypsin-sensitive (serine protease) domains and undergoes transitions between soluble and crystalline forms. However, the significance and the regulatory mechanism or mechanisms governing these transitions are not clearly established. Here, we report the 2.2-Å crystal structure of the trypsin-resistant PMC core consisting of the fifth, sixth, and seventh domains. The observed interdomain interaction explains PMC’s resistance to trypsin and pH-dependent solubility/aggregation. Under acidic pH, weakening of the interdomain interactions exposes individual domains, resulting in not only depolymerization of the crystalline form but also exposure of cystatin domains for inhibition of cysteine proteases. This in turn allows serine protease–mediated fragmentation of PMC, producing ∼10-kD domains with intact inhibitory capacity and faster diffusion, thus enhancing PMC’s inhibitory ability toward cysteine proteases. The crystal structure, light-scattering experiments, isothermal titration calorimetry, and site-directed mutagenesis confirmed the critical role of pH and N-terminal residues in these dynamic transitions between monomer/polymer of PMC. Our data support a notion that the pH-dependent structural regulation of PMC has defense-related implications in tuber physiology via its ability to regulate protein catabolism.     

CHEMICAL MODIFICATION OF L-ASPARAGINASE FROM Cladosporium sp. FOR IMPROVED ACTIVITY AND THERMAL STABILITY

L-Asparaginase (ASNase), an antileukemia enzyme, is facing problems with antigenicity in the blood. Modification of L-asparaginase from Cladosporium sp. was tried to obtain improved stability and improved functionality. In our experiment, modification of the enzyme was tried with bovine serum albumin, ovalbumin by crosslinking using glutaraldehyde, N-bromosuccinimide, and mono-methoxy polyethylene glycol. Modified enzymes were studied for activity, temperature stability, rate constants (k_d), and protection to proteolytic digestion. Modification with ovalbumin resulted in improved enzyme activity that was 10-fold higher compared to native enzyme, while modification with bovine serum albumin through glutaraldehyde cross-linking resulted in high stability of L-asparaginase that was 8.5- and 7.62-fold more compared to native enzyme at 28°C and 37°C by the end of 24 hr. These effects were dependent on the quantity of conjugate formed. Modification also markedly prolonged L-asparaginase half-life and serum stability. N-Bromosuccinimide-modified ASNase presented greater stability with prolonged in vitro half-life of 144 hr to proteolytic digestion relative to unmodified enzyme (93 h). The present work could be seen as producing a modified L-asparaginase with improved activity and stability and can be a potential source for developing therapeutic agents for cancer treatment.     

Proteomic profiling and functional characterization of early and late shoulder osteoarthritis

Introduction

The development of effective treatments for osteoarthritis (OA) has been hampered by a poor understanding of OA at the cellular and molecular levels. Emerging as a disease of the ''whole joint’, the importance of the biochemical contribution of various tissues, including synovium, bone and articular cartilage, has become increasingly significant. Bathing the entire joint structure, the proteomic analysis of synovial fluid (SF) from osteoarthritic shoulders offers a valuable ''snapshot’ of the biologic environment throughout disease progression. The purpose of this study was to identify differentially expressed proteins in early and late shoulder osteoarthritic SF in comparison to healthy SF.

Methods

A quantitative ¹⁸O labeling proteomic approach was employed to identify the dysregulated SF proteins in early (n = 5) and late (n = 4) OA patients compared to control individuals (n = 5). In addition, ELISA was used to quantify six pro-inflammatory and two anti-inflammatory cytokines.

Results

Key results include a greater relative abundance of proteins related to the complement system and the extracellular matrix in SF from both early and late OA. Pathway analyses suggests dysregulation of the acute phase response, liver x receptor/retinoid x receptor (LXR/RXR), complement system and coagulation pathways in both early and late OA. The network related to lipid metabolism was down-regulated in both early and late OA. Inflammatory cytokines including interleukin (IL) 6, IL 8 and IL 18 were up-regulated in early and late OA.

Conclusions

The results suggest a dysregulation of wound repair pathways in shoulder OA contributing to the presence of a ''chronic wound’ that progresses irreversibly from early to later stages of OA. Protease inhibitors were downregulated in late OA suggesting uncontrolled proteolytic activity occurring in late OA. These results contribute to the theory that protease inhibitors represent promising therapeutic agents which could limit proteolytic activity that ultimately leads to cartilage destruction.     

Oligonucleotide Conjugates: Alteration of the Pharmacokinetic Properties of Antisense Agents

Abstract

Cholic acid, cholesterol, several polyamines and polyethylene glycols were conjugated to antisense oligonucleotides targeted to human or murine intercellular adhesion molecule-1 (ICAM-1) mRNA to study their effects on cellular absorption.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

Crystal structure of a type II dehydroquinate dehydratase-like protein from Bifidobacterium longum

Dehydroquinate dehydratase (DHQD) catalyzes the third step in the biosynthetic shikimate pathway. Here we identify a Bifidobacterium longum protein with high sequence homology to type II DHQDs but no detectable DHQD activity under standard assay conditions. A crystal structure reveals that the B. longum protein adopts a DHQD-like tertiary structure but a distinct quaternary state. Apparently forming a dimer, the B. longum protein lacks the active site aspartic acid contributed from a neighboring protomer in the type II DHQD dodecamer. Relating to the absence of protein–protein interactions established in the type II DHQD dodecameric assembly, substantial conformational changes distinguish the would-be active site of the B. longum protein. As B. longum possess no other genes with homology to known DHQDs, these findings imply a unique DHQD activity within B. longum.     

Hasty generalisation and exaggerated certainties: reporting genetic findings in health disparities research

Abstract

In the United States, research that examines potential genetic contributions to health disparities often relies on racial categories. Some see benefit in this research especially for conditions where disparities in health status seem strongly associated with racial identity, such as heart disease and prostate cancer. But this research calls for close scrutiny. First, despite common optimism about genetic research, it may not be the most productive way to examine health disparities. And second, this research has the potential to contribute to racial stereotypes, arguably a prime cause of the health disparities the genetic research actually seeks to ameliorate. Two articles reporting results about genetics and heart disease are used to illustrate these concerns. Both report strong correlations between increased vulnerability to heart disease and black racial identity. Despite serious sampling and analysis problems in these articles, the findings rapidly entered the scientific and popular literature. A possible reason for their ready acceptance is their congruence with stereotypes that attribute poor health and genetic inferiority to minority US populations.     

Synconset Waves and Chains: Spiking Onsets in Synchronous Populations Predict and Are Predicted by Network Structure

Synfire waves are propagating spike packets in synfire chains, which are feedforward chains embedded in random networks. Although synfire waves have proved to be effective quantification for network activity with clear relations to network structure, their utilities are largely limited to feedforward networks with low background activity. To overcome these shortcomings, we describe a novel generalisation of synfire waves, and define ‘synconset wave’ as a cascade of first spikes within a synchronisation event. Synconset waves would occur in ‘synconset chains’, which are feedforward chains embedded in possibly heavily recurrent networks with heavy background activity. We probed the utility of synconset waves using simulation of single compartment neuron network models with biophysically realistic conductances, and demonstrated that the spread of synconset waves directly follows from the network connectivity matrix and is modulated by top-down inputs and the resultant oscillations. Such synconset profiles lend intuitive insights into network organisation in terms of connection probabilities between various network regions rather than an adjacency matrix. To test this intuition, we develop a Bayesian likelihood function that quantifies the probability that an observed synfire wave was caused by a given network. Further, we demonstrate it''s utility in the inverse problem of identifying the network that caused a given synfire wave. This method was effective even in highly subsampled networks where only a small subset of neurons were accessible, thus showing it''s utility in experimental estimation of connectomes in real neuronal-networks. Together, we propose synconset chains/waves as an effective framework for understanding the impact of network structure on function, and as a step towards developing physiology-driven network identification methods. Finally, as synconset chains extend the utilities of synfire chains to arbitrary networks, we suggest utilities of our framework to several aspects of network physiology including cell assemblies, population codes, and oscillatory synchrony.     

Recovery of Renal Function among ESRD Patients in the US Medicare Program

Background

Patients started on long term hemodialysis have typically had low rates of reported renal recovery with recent estimates ranging from 0.9–2.4% while higher rates of recovery have been reported in cohorts with higher percentages of patients with acute renal failure requiring dialysis.

Study Design

Our analysis followed approximately 194,000 patients who were initiated on hemodialysis during a 2-year period (2008 & 2009) with CMS-2728 forms submitted to CMS by dialysis facilities, cross-referenced with patient record updates through the end of 2010, and tracked through December 2010 in the CMS SIMS registry.

Results

We report a sustained renal recovery (i.e no return to ESRD during the available follow up period) rate among Medicare ESRD patients of > 5% - much higher than previously reported. Recovery occurred primarily in the first 2 months post incident dialysis, and was more likely in cases with renal failure secondary to etiologies associated with acute kidney injury. Patients experiencing sustained recovery were markedly less likely than true long-term ESRD patients to have permanent vascular accesses in place at incident hemodialysis, while non-White patients, and patients with any prior nephrology care appeared to have significantly lower rates of renal recovery. We also found widespread geographic variation in the rates of renal recovery across the United States.

Conclusions

Renal recovery rates in the US Medicare ESRD program are higher than previously reported and appear to have significant geographic variation. Patients with diagnoses associated with acute kidney injury who are initiated on long-term hemodialysis have significantly higher rates of renal recovery than the general ESRD population and lower rates of permanent access placement.