Beta-catenin is linked with colorectal cancer (CRC). Therefore, it is of interest to design and develop novel compounds to combat CRC. Hence, we document compounds (chlorogenic acid, gallic acid, protocatechuic acid, quercetin and vanillic acid) from Lycopersicon esculentum with optimal binding features for further consideration. 相似文献
Chronological age conveys only a rough approximation of the maturational status of a person whereas skeletal maturity indicators give a more accurate estimation. Therefore, it is of interest to document the correlation between chronological and skeletal age using CVMI and modified MP3 methods. A total of 39 subjects between the age ranges of 9-16 years were selected for this study. Pre-treatment lateral cephalograms and hand-wrist radiographs of the subjects were used. The skeletal age was analyzed by the Cervical Vertebrae Maturity Index (CVMI) and modified MP3 methods. The data was analyzed with SPSS software version 23.00. Kendall''s Tau correlation test was performed to estimate the correlation between chronological age and skeletal age among the subjects and a linear regression test was also performed. Positive correlation was found between chronological age and skeletal age assessed by CVMI method (r= 0.398) and modified MP3 method (r=0.382) with p value >0.003. Thus it can be concluded that there was a positive correlation between chronological age and skeletal age among all the subjects. 相似文献
Studying the pattern of species richness is crucial in understanding the diversity and distribution of organisms in the earth. Climate and human influences are the major driving factors that directly influence the large‐scale distributions of plant species, including gymnosperms. Understanding how gymnosperms respond to climate, topography, and human‐induced changes is useful in predicting the impacts of global change. Here, we attempt to evaluate how climatic and human‐induced processes could affect the spatial richness patterns of gymnosperms in China. Initially, we divided a map of the country into grid cells of 50 × 50 km2 spatial resolution and plotted the geographical coordinate distribution occurrence of 236 native gymnosperm taxa. The gymnosperm taxa were separated into three response variables: (a) all species, (b) endemic species, and (c) nonendemic species, based on their distribution. The species richness patterns of these response variables to four predictor sets were also evaluated: (a) energy–water, (b) climatic seasonality, (c) habitat heterogeneity, and (d) human influences. We performed generalized linear models (GLMs) and variation partitioning analyses to determine the effect of predictors on spatial richness patterns. The results showed that the distribution pattern of species richness was highest in the southwestern mountainous area and Taiwan in China. We found a significant relationship between the predictor variable set and species richness pattern. Further, our findings provide evidence that climatic seasonality is the most important factor in explaining distinct fractions of variations in the species richness patterns of all studied response variables. Moreover, it was found that energy–water was the best predictor set to determine the richness pattern of all species and endemic species, while habitat heterogeneity has a better influence on nonendemic species. Therefore, we conclude that with the current climate fluctuations as a result of climate change and increasing human activities, gymnosperms might face a high risk of extinction. 相似文献
Molecular and Cellular Biochemistry - β-cell dysfunction is a critical determinant for both type 1 diabetes and type 2 diabetes and β-cells are shown to be highly susceptible to cellular... 相似文献
India is endowed with a variety of coastal wetlands viz., mangroves, seagrasses, saltmarshes, coral reefs, lagoons and tidal flats, and the country is also a signatory to the Ramsar Convention on Wetlands and the Convention of Biological Diversity, besides having a robust framework of laws and policies, governing the wetland conservation. However, the conservation strategies can better be improved in the context of increasing pressures and threats and limited success of restoration/rehabilitation. Land conversion and ecological degradation of coastal wetlands are the stressors, associated with rapid coastal developmental activities and climate change. The coastal wetlands require desired habitat niche and hence, the conversion of coastal wetlands to other land uses (including agricultural and urban lands) may lead to permanent loss, whereas ecologically degraded coastal wetlands may be resilient if supported by effective protection measures. Preventing the habitat conversion and maximizing the adaptive potential (viz., the ability of populations or species to adapt to rapid environmental change with minimal disruption) by preserving the ecological health are the need of the hour to safeguard the existing coastal wetlands and sustain the provisional ecosystem services offered by them rather than short-term increase in area by unproductive restoration/rehabilitation efforts. Since coastal wetlands are flow through ecosystems, preserving the hydrological connectivity, facilitating the connectivity between adjacent ecosystems and protection of natural corridors are potential strategies that are required to enhance the adaptive potential of coastal wetlands. This analysis calls for site-specific, long-term and integrated ecosystem-based protection, management and rehabilitation strategies based on scientific principles and enforcing the effective legislative measures to regularize the coastal developmental activities in India.
Potato (Solanum tuberosum) multicystatin (PMC) is a unique cystatin composed of eight repeating units, each capable of inhibiting cysteine proteases. PMC is a composite of several cystatins linked by trypsin-sensitive (serine protease) domains and undergoes transitions between soluble and crystalline forms. However, the significance and the regulatory mechanism or mechanisms governing these transitions are not clearly established. Here, we report the 2.2-Å crystal structure of the trypsin-resistant PMC core consisting of the fifth, sixth, and seventh domains. The observed interdomain interaction explains PMC’s resistance to trypsin and pH-dependent solubility/aggregation. Under acidic pH, weakening of the interdomain interactions exposes individual domains, resulting in not only depolymerization of the crystalline form but also exposure of cystatin domains for inhibition of cysteine proteases. This in turn allows serine protease–mediated fragmentation of PMC, producing ∼10-kD domains with intact inhibitory capacity and faster diffusion, thus enhancing PMC’s inhibitory ability toward cysteine proteases. The crystal structure, light-scattering experiments, isothermal titration calorimetry, and site-directed mutagenesis confirmed the critical role of pH and N-terminal residues in these dynamic transitions between monomer/polymer of PMC. Our data support a notion that the pH-dependent structural regulation of PMC has defense-related implications in tuber physiology via its ability to regulate protein catabolism. 相似文献
L-Asparaginase (ASNase), an antileukemia enzyme, is facing problems with antigenicity in the blood. Modification of L-asparaginase from Cladosporium sp. was tried to obtain improved stability and improved functionality. In our experiment, modification of the enzyme was tried with bovine serum albumin, ovalbumin by crosslinking using glutaraldehyde, N-bromosuccinimide, and mono-methoxy polyethylene glycol. Modified enzymes were studied for activity, temperature stability, rate constants (kd), and protection to proteolytic digestion. Modification with ovalbumin resulted in improved enzyme activity that was 10-fold higher compared to native enzyme, while modification with bovine serum albumin through glutaraldehyde cross-linking resulted in high stability of L-asparaginase that was 8.5- and 7.62-fold more compared to native enzyme at 28°C and 37°C by the end of 24 hr. These effects were dependent on the quantity of conjugate formed. Modification also markedly prolonged L-asparaginase half-life and serum stability. N-Bromosuccinimide-modified ASNase presented greater stability with prolonged in vitro half-life of 144 hr to proteolytic digestion relative to unmodified enzyme (93 h). The present work could be seen as producing a modified L-asparaginase with improved activity and stability and can be a potential source for developing therapeutic agents for cancer treatment. 相似文献
The development of effective treatments for osteoarthritis (OA) has been hampered by a poor understanding of OA at the cellular and molecular levels. Emerging as a disease of the ''whole joint’, the importance of the biochemical contribution of various tissues, including synovium, bone and articular cartilage, has become increasingly significant. Bathing the entire joint structure, the proteomic analysis of synovial fluid (SF) from osteoarthritic shoulders offers a valuable ''snapshot’ of the biologic environment throughout disease progression. The purpose of this study was to identify differentially expressed proteins in early and late shoulder osteoarthritic SF in comparison to healthy SF.
Methods
A quantitative 18O labeling proteomic approach was employed to identify the dysregulated SF proteins in early (n = 5) and late (n = 4) OA patients compared to control individuals (n = 5). In addition, ELISA was used to quantify six pro-inflammatory and two anti-inflammatory cytokines.
Results
Key results include a greater relative abundance of proteins related to the complement system and the extracellular matrix in SF from both early and late OA. Pathway analyses suggests dysregulation of the acute phase response, liver x receptor/retinoid x receptor (LXR/RXR), complement system and coagulation pathways in both early and late OA. The network related to lipid metabolism was down-regulated in both early and late OA. Inflammatory cytokines including interleukin (IL) 6, IL 8 and IL 18 were up-regulated in early and late OA.
Conclusions
The results suggest a dysregulation of wound repair pathways in shoulder OA contributing to the presence of a ''chronic wound’ that progresses irreversibly from early to later stages of OA. Protease inhibitors were downregulated in late OA suggesting uncontrolled proteolytic activity occurring in late OA. These results contribute to the theory that protease inhibitors represent promising therapeutic agents which could limit proteolytic activity that ultimately leads to cartilage destruction. 相似文献
Abstract Cholic acid, cholesterol, several polyamines and polyethylene glycols were conjugated to antisense oligonucleotides targeted to human or murine intercellular adhesion molecule-1 (ICAM-1) mRNA to study their effects on cellular absorption. 相似文献
Abstract A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione (6) has been accomplished. The structural conformation of (6) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside (6) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0. 相似文献