Prohibitin is required for Ras-induced Raf-MEK-ERK activation and epithelial cell migration

Ras proteins control the signalling pathways that are responsible for normal growth and malignant transformation. Raf protein kinases are direct Ras effector proteins that initiate the mitogen-activated protein kinase (MAPK) cascade, which mediates diverse biological functions such as cell growth, survival and differentiation. Here we show that prohibitin, a ubiquitously expressed and evolutionarily conserved protein is indispensable for the activation of the Raf-MEK-ERK pathway by Ras. The membrane targeting and activation of C-Raf by Ras needs prohibitin in vivo. In addition, direct interaction with prohibitin is required for C-Raf activation. C-Raf kinase fails to interact with the active Ras induced by epidermal growth factor in the absence of prohibitin. Moreover, in prohibitin-deficient cells the adhesion complex proteins cadherin and beta-catenin relocalize to the plasma membrane and thereby stabilize adherens junctions. Our data show an unexpected role of prohibitin in the activation of the Ras-Raf signalling pathway and in modulating epithelial cell adhesion and migration.     

Sprouty2 acts at the Cbl/CIN85 interface to inhibit epidermal growth factor receptor downregulation

The ubiquitin ligase Cbl mediates ubiquitination of activated receptor tyrosine kinases (RTKs) and interacts with endocytic scaffold complexes, including CIN85/endophilins, to facilitate RTK endocytosis and degradation. Several mechanisms regulate the functions of Cbl to ensure the fine-tuning of RTK signalling and cellular homeostasis. One regulatory mechanism involves the binding of Cbl to Sprouty2, which sequesters Cbl away from activated epidermal growth factor receptors (EGFRs). Here, we show that Sprouty2 associates with CIN85 and acts at the interface between Cbl and CIN85 to inhibit EGFR downregulation. The CIN85 SH3 domains A and C bind specifically to proline-arginine motifs present in Sprouty2. Intact association between Sprouty2, Cbl and CIN85 is required for inhibition of EGFR endocytosis as well as EGF-induced differentiation of PC12 cells. Moreover, Sprouty4, which lacks CIN85-binding sites, does not inhibit EGFR downregulation, providing a molecular explanation for functional differences between Sprouty isoforms. Sprouty2 therefore acts as an inducible inhibitor of EGFR downregulation by targeting both the Cbl and CIN85 pathways.     

Lipid droplets gain PAT family proteins by interaction with specialized plasma membrane domains

Proteins of the PAT family, named after perilipin, adipophilin, and TIP47 (tail-interacting protein of 47 kDa), are associated with lipid droplets and have previously been localized by immunofluorescence microscopy exclusively to the droplet surface. These proteins are considered not to be present in any other subcellular compartment. By applying the high resolution technique of freeze-fracture electron microscopy combined with immunogold labeling, we now demonstrate that in macrophages and adipocytes PAT family proteins are, first, distributed not only in the surface but also throughout the lipid droplet core and, second, are integral components of the plasma membrane. Under normal culture conditions these proteins are dispersed in the cytoplasmic leaflet of the plasma membrane. Stimulation of lipid droplet formation by incubation of the cells with acetylated low density lipoprotein leads to clustering of the PAT family proteins in raised plasma membrane domains. Fractures penetrating beneath the plasma membrane demonstrate that lipid droplets are closely apposed to these domains. A similar distribution pattern of labeling in the form of linear aggregates within the clusters is apparent in the cytoplasmic monolayer of the plasma membrane and the immediately adjacent outer monolayer of the lipid droplet. The aggregation of the PAT family proteins into such assemblies may facilitate carrier-mediated lipid influx from the extracellular environment into the lipid droplet. Lipid droplets appear to acquire their PAT proteins by interaction with plasma membrane domains enriched in these proteins.     

Loss of CD127 expression defines an expansion of effector CD8+ T cells in HIV-infected individuals

The immunodeficiency that follows HIV infection is related to the virus-mediated killing of infected CD4(+) T cells, the chronic activation of the immune system, and the impairment of T cell production. In this study we show that in HIV-infected individuals the loss of IL-7R (CD127) expression defines the expansion of a subset of CD8(+) T cells, specific for HIV as well as other Ags, that show phenotypic (i.e., loss of CCR7 and CD62 ligand expression with enrichment in activated and/or proliferating cells) as well as functional (i.e., production of IFN-gamma, but not IL-2, decreased ex vivo proliferative potential and increased susceptibility to apoptosis) features of effector T cells. Importantly, in HIV-infected individuals the levels of CD8(+)CD127(-) T cells are directly correlated with the main markers of disease progression (i.e., plasma viremia and CD4(+) T cell depletion) as well as with the indices of overall T cell activation. In all, these results identify the expansion of CD8(+)CD127(-) effector-like T cells as a novel feature of the HIV-associated immune perturbation. Further studies are thus warranted to determine whether measurements of CD127 expression on CD8(+) T cells may be useful in the clinical management of HIV-infected individuals.     

Mechanism of activation of human heparanase investigated by protein engineering

The aim of this study was to investigate the mechanism of activation of human heparanase, a key player in heparan sulfate degradation, thought to be involved in normal and pathologic cell migration processes. Active heparanase arises as a product of a series of proteolytic processing events. Upon removal of the signal peptide, the resulting, poorly active 65 kDa species undergoes the excision of an intervening 6 kDa fragment generating an 8 kDa polypeptide and a 50 kDa polypeptide, forming the fully active heterodimer. By engineering of tobacco etch virus protease cleavage sites at the N- and C-terminal junctions of the 6 kDa fragment, we were able to reproduce the proteolytic activation of heparanase in vitro using purified components, showing that cleavage at both sites leads to activation in the absence of additional factors. On the basis of multiple-sequence alignment of the N-terminal fragment, we conclude that the first beta/alpha/beta element of the postulated TIM barrel fold is contributed by the 8 kDa subunit and that the excised 6 kDa fragment connects the second beta-strand and the second alpha-helix of the barrel. Substituting the 6 kDa fragment with the topologically equivalent loop from Hirudinaria manillensis hyaluronidase or connecting the 8 and 50 kDa fragments with a spacer of three glycine-serine pairs resulted in constitutively active, single-chain heparanases which were comparable to the processed, heterodimeric enzyme with regard to specific activity, chromatographic profile of hydrolysis products, complete inhibition at NaCl concentrations above 600 mM, a pH optimum of pH approximately 5, and inhibition by heparin with IC(50)s of 0.9-1.5 ng/microL. We conclude that (1) the heparanase heterodimer (alpha/beta)(8)-TIM barrel fold is contributed by both 8 and 50 kDa subunits with the 6 kDa connecting fragment leading to inhibition of heparanase by possibly obstructing access to the active site, (2) proteolytic excision of the 6 kDa fragment is necessary and sufficient for heparanase activation, and (3) our findings open the way to the production of recombinant, constitutively active single-chain heparanase for structural studies and for the identification of inhibitors.     

Novel regulation of mitotic exit by the Cdc42 effectors Gic1 and Gic2

The guanine nucleotide exchange factor Cdc24, the GTPase Cdc42, and the Cdc42 effectors Cla4 and Ste20, two p21-activated kinases, form a signal transduction cascade that promotes mitotic exit in yeast. We performed a genetic screen to identify components of this pathway. Two related bud cortex-associated Cdc42 effectors, Gic1 and Gic2, were obtained as factors that promoted mitotic exit independently of Ste20. The mitotic exit function of Gic1 was dependent on its activation by Cdc42 and on the release of Gic1 from the bud cortex. Gic proteins became essential for mitotic exit when activation of the mitotic exit network through Cdc5 polo kinase and the bud cortex protein Lte1 was impaired. The mitotic exit defect of cdc5-10 Deltalte1 Deltagic1 Deltagic2 cells was rescued by inactivation of the inhibiting Bfa1-Bub2 GTPase-activating protein. Moreover, Gic1 bound directly to Bub2 and prevented binding of the GTPase Tem1 to Bub2. We propose that in anaphase the Cdc42-regulated Gic proteins trigger mitotic exit by interfering with Bfa1-Bub2 GTPase-activating protein function.     

Coenzyme site-directed mutants of photosynthetic A4-GAPDH show selectively reduced NADPH-dependent catalysis, similar to regulatory AB-GAPDH inhibited by oxidized thioredoxin

Chloroplast glyceraldehyde-3-phosphate dehydrogenase (GAPDH) of higher plants uses both NADP(H) and NAD(H) as coenzyme and consists of one (GapA) or two types of subunits (GapA, GapB). AB-GAPDH is regulated in vivo through the action of thioredoxin and metabolites, showing higher kinetic preference for NADPH in the light than in darkness due to a specific effect on kcat(NADPH). Previous crystallographic studies on spinach chloroplast A4-GAPDH complexed with NADP or NAD showed that residues Thr33 and Ser188 are involved in NADP over NAD selectivity by interacting with the 2'-phosphate group of NADP. This suggested a possible involvement of these residues in the regulatory mechanism. Mutants of recombinant spinach GapA (A4-GAPDH) with Thr33 or Ser188 replaced by Ala (T33A, S188A and double mutant T33A/S188A) were produced, expressed in Escherichia coli, and compared to wild-type recombinant A4-GAPDH, in terms of crystal structures and kinetic properties. Affinity for NADPH was decreased significantly in all mutants, and kcat(NADPH) was lowered in mutants carrying the substitution of Ser188. NADH-dependent activity was unaffected. The decrease of kcat/Km of the NADPH-dependent reaction in Ser188 mutants resembles the behaviour of AB-GAPDH inhibited by oxidized thioredoxin, as confirmed by steady-state kinetic analysis of native enzyme. A significant expansion of size of the A4-tetramer was observed in the S188A mutant compared to wild-type A4. We conclude that in the absence of interactions between Ser188 and the 2'-phosphate group of NADP, the enzyme structure relaxes to a less compact conformation, which negatively affects the complex catalytic cycle of GADPH. A model based on this concept might be developed to explain the in vivo light-regulation of the GAPDH.     

Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.     

Genomic and expression analysis of the 3q25-q26 amplification unit reveals TLOC1/SEC62 as a probable target gene in prostate cancer

Gain at chromosome 3q25-q26 has been reported to commonly occur in prostate cancer. To map the 3q25-q26 amplification unit and to identify the candidate genes of amplification, we did fluorescence in situ hybridization and quantitative real-time PCR for gene copy number and mRNA expression measurements in prostate cancer cell lines and prostate cancer samples from radical prostatectomy specimens. The minimal overlapping region of DNA copy number gains in the cell lines could be narrowed down to 700 kb at 3q26.2. Of all positional and functional candidates in this region, the gene TLOC1/SEC62 revealed the highest frequency (50%) of copy number gains in the prostate cancer samples and was found to be up-regulated at the mRNA level in all samples analyzed. TLOC1/Sec62 protein was also shown to be overexpressed by Western blot analysis. Intriguingly, the TLOC1/SEC62 gene copy number was increased in prostate tumors from patients who had a lower risk of and a longer time to progression following radical prostatectomy. These findings make TLOC1/SEC62 the best candidate within the 3q amplification unit in prostate cancer. TLOC1/Sec62 protein is a component of the endoplasmic reticulum protein translocation machinery, whose function during prostate carcinogenesis remains to be determined.