Safety Indices during Fetal Echocardiography at the Time of First-Trimester Scan Are Machine Dependent

The aim of our study was to evaluate the thermal index (TI) and mechanical index (MI), during the assessment of the fetal heart at the time of first-trimester scan, with different ultrasound machines. This was part of an observational study conducted in patients undergoing routine first-trimester screening. Cases were examined with Voluson E8 or 730Pro scanners using 2–8 MHz transabdominal probes. TI and MI were retrieved from the saved displays while in gray mode, color flow mapping and pulsed-wave (PW) Doppler examinations of the fetal heart and also from the ductus venosus (DV) assessment. We evaluated 552 fetal cardiac examinations, 303 (55%) performed with Voluson E8 and 249 (45%) with Voluson 730Pro ultrasound machines. The gray-scale exam of the heart and the PW Doppler DV assessment had TI values significantly lower for the Voluson E8 group (median, 0.04 vs. 0.2 and 0.1 vs. 0.2, respectively). The MI values from gray-scale and color flow mapping of the heart were significantly lower (median, 0.6 vs, 1.2 and 0.7 vs. 1) and for PW Doppler exam of the tricuspid flow were significantly higher (median 0.4 vs. 0.2) in the Voluson E8 group. The TI values from Doppler examinations of the heart, either color flow or PW imaging and MI values from DV assessment were not significantly different between the two groups. A different (newer) generation of ultrasound equipment provides lower or at least the same safety indices for most of the first-trimester heart examinations.     

Early Evaluation and Monitoring of Critical Patients with Acute Respiratory Distress Syndrome (ARDS) Using Specific Genetic Polymorphisms

A high percentage of critical patients are found to develop acute respiratory distress syndrome (ARDS). Several studies have reported high mortality rates in these cases which are most frequently associated with multiple organ dysfunctions syndrome. Lately, many efforts have been made to evaluate and monitor ARDS in critical patients. In this regard, the assessment of genetic polymorphisms responsible for developing ARDS present as a challenge and are considered future biomarkers. Early detection of the specific polymorphic gene responsible for ARDS in critically ill patients can prove to be a useful tool in the future, able to help decrease the mortality rates in these cases. Moreover, identifying the genetic polymorphism in these patients can help in the implementation of a personalized intensive therapy scheme for every type of patient, based on its genotype.     

Clara cell secretory protein and phospholipase A2 activity modulate acute ventilator-induced lung injury in mice.

Lung vascular permeability is acutely increased by high-pressure and high-volume ventilation. To determine the roles of mechanically activated cytosolic PLA2 (cPLA2)and Clara cell secretory protein (CCSP), a modulator of cPLA2 activity, we compared lung injury with and without a PLA2 inhibitor in wild-type mice and CCSP-null mice (CCSP-/-) ventilated with high and low peak inflation pressures (PIP) for 2- or 4-h periods. After ventilation with high PIP, we observed significant increases in the bronchoalveolar lavage albumin concentrations, lung wet-to-dry weight ratios, and lung myeloperoxidase in both genotypes compared with unventilated controls and low-PIP ventilated mice. All injury variables except myeloperoxidase were significantly greater in the CCSP-/- mice relative to wild-type mice. Inhibition of cPLA2 in wild-type and CCSP-/- mice ventilated at high PIP for 4 h significantly reduced bronchoalveolar lavage albumin and total protein and lung wet-to-dry weight ratios compared with vehicle-treated mice of the same genotype. Membrane phospho-cPLA2 and cPLA2 activities were significantly elevated in lung homogenates of high-PIP ventilated mice of both genotypes but were significantly higher in the CCSP-/- mice relative to the wild-type mice. Inhibition of cPLA2 significantly attenuated both the phospho-cPLA2 increase and increased cPLA2 activity due to high-PIP ventilation. We propose that mechanical activation of the cPLA2 pathway contributes to acute high PIP-induced lung injury and that CCSP may reduce this injury through inhibition of the cPLA2 pathway and reduction of proinflammatory products produced by this pathway.     

Caveolin-1 overexpression correlates with tumour progression markers in pancreatic ductal adenocarcinoma

The assessment of caveolin-1 (Cav-1) as a marker of tumor aggressiveness in pancreatic ductal adenocarcinoma (PDAC). In this study, we examined the expression of Cav-1 in 34 human PDAC tissue samples and the associated peritumoral tissues by immunohistochemistry and western blot. Additionally, we correlated Cav-1 expression with other tissue (Ki-67, p53) and serum (CA 19-9) tumor markers. In the tumor-derived tissue, both tumor cells and blood vessels expressed Cav-1. In contrast, in peritumoral tissue, Cav-1 expression was confined mainly to blood vessels and was only occasionally expressed in ductal or parenchymal cells. Western blot analysis confirmed the overexpression of Cav-1 in pancreatic tumors compared with peritumoral tissue. Cav-1 expression in tumor tissues was correlated with both the Ki-67 LI (r = 0.95, P < 0.0001) and p53 expression (χ2 = 9.91, P < 0.005). Overexpression of Cav-1 was associated with tumor size, grade and stage and Cav-1 expression in tumors was correlated with an increased serum level of CA 19-9 (r = 0.795, P < 0.001). Based on the results of this study, the inclusion of Cav-1 in a putative panel of biomarkers predicting pancreatic cancer aggressiveness is warranted.     

The NCI-N87 cell line as a gastric epithelial barrier model for drug permeability assay

The objective of this study was to evaluate the human NCI-N87 cell line as a model for gastric permeability drug studies under pH conditions of the stomach. The optimal conditions that led NCI-N87 cells to form a typical differentiated gastric epithelial barrier were a seeding density of 2.5 × 10⁵ cells/cm² on porous inserts and growth in serum-complemented RPMI-1640 medium until 18–27 days post-confluency. The resulting cell monolayers showed moderately high transepithelial electrical resistance (TEER) values of about 500 Ω cm², cells of polygonal morphology expressing E-cadherin and ZO-1 proteins at their contact surfaces, and production of mucus clusters. The monolayers withstood apical pH of 7.4 down to 3.0 with the basal pH fixed at 7.4. The apparent permeability coefficients (P_app) of model compounds were evaluated in the apical-to-basolateral and basolateral-to-apical directions under different pH gradients. The monolayers were impermeable to the integrity marker Lucifer Yellow (low P_app of 0.3–1.1 × 10⁻⁶ cm/s). The furosemide P_app (0.4–1.5 × 10⁻⁵ cm/s) were slightly dependent on pH but remained moderate. The caffeine P_app (4.2–5.0 × 10⁻⁵ cm/s) were higher and insensitive to pH changes. The NCI-N87 cell line provides a useful in vitro tool to assess gastric drug permeability and absorption under physiologic conditions prevailing in the human stomach.     

The Light Skin Allele of SLC24A5 in South Asians and Europeans Shares Identity by Descent

Skin pigmentation is one of the most variable phenotypic traits in humans. A non-synonymous substitution (rs1426654) in the third exon of SLC24A5 accounts for lighter skin in Europeans but not in East Asians. A previous genome-wide association study carried out in a heterogeneous sample of UK immigrants of South Asian descent suggested that this gene also contributes significantly to skin pigmentation variation among South Asians. In the present study, we have quantitatively assessed skin pigmentation for a largely homogeneous cohort of 1228 individuals from the Southern region of the Indian subcontinent. Our data confirm significant association of rs1426654 SNP with skin pigmentation, explaining about 27% of total phenotypic variation in the cohort studied. Our extensive survey of the polymorphism in 1573 individuals from 54 ethnic populations across the Indian subcontinent reveals wide presence of the derived-A allele, although the frequencies vary substantially among populations. We also show that the geospatial pattern of this allele is complex, but most importantly, reflects strong influence of language, geography and demographic history of the populations. Sequencing 11.74 kb of SLC24A5 in 95 individuals worldwide reveals that the rs1426654-A alleles in South Asian and West Eurasian populations are monophyletic and occur on the background of a common haplotype that is characterized by low genetic diversity. We date the coalescence of the light skin associated allele at 22–28 KYA. Both our sequence and genome-wide genotype data confirm that this gene has been a target for positive selection among Europeans. However, the latter also shows additional evidence of selection in populations of the Middle East, Central Asia, Pakistan and North India but not in South India.     

Anisotropic elastic bending models of DNA

Simplified elastic rod models of DNA were developed in which the rigidity of DNA is sequence dependent and asymmetrical, i.e. the bending is facilitated towards the major groove. By subjecting the models to bending load in various directions perpendicular to the longitudinal axis of DNA, the bending deformation and the average conformation of the models can be estimated using finite element methods. Intrinsically curved sequence motifs [(aaaattttgc)_n, (tctctaaaaaatatataaaaa)_n] are found to be curved by this modelling procedure whereas the average conformation of homopolymers and straight motifs [(a)_n, (atctaatctaacacaacaca)_n] show negligible or no curvature. This suggests that sequence dependent asymmetric rigidity of DNA can provide an explanation in itself for intrinsic DNA curvature. The average rigidity of various DNA sequences was calculated and a good correlation was found with such quantities as the free energy change upon the binding of the Cro repressor, the base stacking energy and the thermal fluctuations at room temperature.