The consequences of gustatory deafferentation on body mass and feeding patterns in the rat

The contribution of orosensory signals, especially taste, on body mass, and feeding and drinking patterns in the rat was examined. Gustatory deafferentation was produced by bilateral transection of the chorda tympani, glossopharyngeal, and greater superficial petrosal nerves. Total calories consumed from sweetened-milk diet and oil-chow mash by the nerve-transected rats significantly decreased relative to sham-operated controls, mostly attributable to decreases in bout number, but not size. Nevertheless, caloric intake steadily increased over the postsurgical observation period, but body mass remained below both presurgical baseline and control levels and did not significantly increase over this time. After the sweetened-milk diet/oil-chow mash phase, rats received a series of sucrose preference tests. Interestingly, the nerve-transected rats preferred sucrose, and intake did not differ from controls, likely due to the stimulus sharing some nontaste chemosensory properties with the sweetened-milk diet. The neurotomized rats initiated a greater number of sucrose-licking bouts that were smaller in size and slower in licking rate, compared with control rats, and, unlike in control rats, the latter two bout parameters did not vary across concentration. Thus, in the absence of gustatory neural input, body mass is more stable compared with the progressive trajectory of weight gain seen in intact rats, and caloric intake initially decreases but recovers. The consequences of gustatory neurotomy on processes that determine meal initiation (bout number) and meal termination (bout size) are not fixed and appear to be influenced by presurgical experience with food stimuli coupled with its nongustatory chemosensory properties.     

Cellulases: ambiguous nonhomologous enzymes in a genomic perspective

The key material for bioethanol production is cellulose, which is one of the main components of the plant cell wall. Enzymatic depolymerization of cellulose is an essential step in bioethanol production, and can be accomplished by fungal and bacterial cellulases. Most of the biochemically characterized bacterial cellulases come from only a few cellulose-degrading bacteria, thus limiting our knowledge of a range of cellulolytic activities that exist in nature. The recent explosion of genomic data offers a unique opportunity to search for novel cellulolytic activities; however, the absence of clear understanding of structural and functional features that are important for reliable computational identification of cellulases precludes their exploration in the genomic datasets. Here, we explore the diversity of cellulases and propose a genomic approach to overcome this bottleneck.     

The two steps of group II intron self-splicing are mechanistically distinguishable.

The two transesterification reactions catalyzed by self-splicing group II introns take place in either two active sites or two conformations of a single active site involving rearrangements of the positions of the reacting groups. We have investigated the effects on the rates of the chemical steps of the two reactions due to sulfur substitution of nonbridging oxygens at both the 5' and 3' splice sites as well as the deoxyribose substitution of the ribose 2' hydroxyl group at the 5' splice site. The data suggest that the two active sites differ in their interactions with several of these groups. Specifically, sulfur substitution of the pro-Sp nonbridging oxygen at the 5' splice site reduces the chemical rate of the step one branching reaction by at least 250-fold, whereas substitution of the pro-Sp oxygen at the 3' splice site has only a 4.5-fold effect on the chemical rate of step two. Previous work demonstrated that the Rp phosphorothioate substitutions at both the 5' and 3' splice sites reduced the rate of both steps of splicing to an undetectable level. These results suggest that either two distinct active sites catalyze the two steps or that more significant alterations must be made in a single bifunctional active site to accommodate the two different reactions.     

Daily activity patterns of coyotes (Canis latrans) in a tropical deciduous forest of western Mexico

We studied the activity patterns of the coyote (Canis latrans) in a tropical deciduous forest in the Mexican Pacific coast over 3 years. Fifteen coyotes (six females, nine males) were fitted with radio-collars equipped with activity sensors to determine the influence of seasonality (dry vs. wet), gender (males vs. females) and diel intervals (dusk, night, dawn, and day) on activity patterns. We found differences in activity patterns between diel intervals, but the only pair of diel intervals that showed significant differences was dawn (more active) vs. day (less active). We found no differences due to sex or season on any of the four studied diel intervals. Coyote activity patterns in this tropical forest could be responding to prey availability, human avoidance or thermoregulation.     

Spatial and temporal distribution of archaeal diversity in meromictic,hypersaline Ocnei Lake (Transylvanian Basin,Romania)

Saline, meromictic lakes with significant depth are usually formed as a result of salt mining activity. Ocnei Lake is one of the largest Transylvanian (Central Romania) neutral, hypersaline lake of man-made origin. We aimed to survey the seasonal dynamics of archaeal diversity in the water column of Ocnei Lake by employing microbiological methods as well as molecular techniques based on the sequence analysis of the 16S rRNA gene. We found that archaeal diversity in the water column increased with depth and salinity, with 8 OTUs being detected in the epilimnion compared to 21 found in the chemocline, and 32 OTUs in the monimolimnion. Down to 3.5 m depth, the archaeal community was markedly dominated by the presence of an unclassified archaeon sharing 93 % sequence identity to Halogeometricum spp. At the chemocline, the shift in archaeal community composition was associated with an increase in salinity, the main factor affecting the vertical distribution of archaeal assemblages. It appears that the microoxic and hypersaline monimolimnion is populated by several major haloarchaeal taxa, with minor fluctuations in their relative abundances throughout all seasons. The culturable diversity was reasonably correlated to the dominant OTUs obtained by molecular methods. Our results indicate that Ocnei Lake represents a relatively stable extreme habitat, accommodating a diverse and putatively novel archaeal community, as 30 % of OTUs could not be classified at the genus level.     

Anisotropic elastic bending models of DNA

Simplified elastic rod models of DNA were developed in which the rigidity of DNA is sequence dependent and asymmetrical, i.e. the bending is facilitated towards the major groove. By subjecting the models to bending load in various directions perpendicular to the longitudinal axis of DNA, the bending deformation and the average conformation of the models can be estimated using finite element methods. Intrinsically curved sequence motifs [(aaaattttgc)_n, (tctctaaaaaatatataaaaa)_n] are found to be curved by this modelling procedure whereas the average conformation of homopolymers and straight motifs [(a)_n, (atctaatctaacacaacaca)_n] show negligible or no curvature. This suggests that sequence dependent asymmetric rigidity of DNA can provide an explanation in itself for intrinsic DNA curvature. The average rigidity of various DNA sequences was calculated and a good correlation was found with such quantities as the free energy change upon the binding of the Cro repressor, the base stacking energy and the thermal fluctuations at room temperature.     

The influence of kainic acid on core temperature and cytokine levels in the brain

Excitotoxic brain injury is associated with hyperthermia, and there are data showing beneficial effects of hypothermia on neurodegeneration and that hyperthermia facilitates the neurodegeneration. Cytokines are inflammatory proteins that seem to be involved in the neuroinflammation associated with epilepsy. Core temperature changes caused by the epileptogenic glutamate analogue kainic acid (KA) were investigated in relation to changes in levels of the pro-inflammatory cytokines interleukin-1beta (IL-1beta) and interleukin-6 (IL-6), and the endogenous interleukin-1 receptor antagonist (IL-1ra). The temperature was measured every 10 min during the first hour, and at 90 and 120 min, and hourly until 8 h after KA-injection (10 mg/kg). The cytokines were measured in the hypothalamus, a site of temperature regulation, and in hippocampus, cerebellum, and frontal cortex. KA induced a brief hypothermia followed by hyperthermia. IL-1beta levels were increased after KA-administration in all brain regions examined and, excepting hippocampus, returned to baseline levels at 24 h. The hippocampal IL-1ra levels were significantly increased at 24 h, whereas no changes in IL-6 levels were observed. The changes in IL-1beta levels and in ratios between the levels of the three cytokines, may account for some of the temperature changes and the behavioural manifestations induced by KA.     

Protective effects of a plant histaminase in myocardial ischaemia and reperfusion injury in vivo

Grass pea seedling histaminase (a copper-diamine oxidase) was found to exert a significant cardioprotection against post-ischaemic reperfusion damage. Electrocardiogram (ECG) recordings from the rats subjected in vivo to ischaemia and reperfusion showed ventricular tachycardia (VT) and ventricular fibrillations (VF) occurring in 9 out of 12 untreated rats whereas no ventricular arrhythmias were found under histaminase (80U/kg body weight) treatment (n=16 rats). Computer-assisted morphometry of the ischaemic reperfused hearts stained with nitroblue tetrazolium showed the extension of damaged myocardium (area at risk and infarct size) significantly reduced in rats treated with histaminase, in comparison with the non-treated rats, whereas no protection was found with the semicarbazide inactivated histaminase. Biochemical markers of ischaemia-reperfusion myocardial tissue damage: malonyldialdehyde (MDA), tissue calcium concentration, myeloperoxidase (MPO), and apoptosis indicator caspase-3 were significantly elevated in untreated post-ischaemic reperfused rats, but significantly reduced under histaminase protection. In conclusion, plant histaminase appears to protect hearts from ischaemia-reperfusion injury by more than one mechanism, essentially involving histamine oxidation, and possibly as reactive oxygen species scavenger, presenting good perspectives for a novel therapeutic approach in treatment of ischaemic heart pathology.     

Comparative study of RT23 and IC-65 tuberculins tested on children with tuberculosis

This study, conducted in 2009, proposed to evaluate and compare the biological potency of two different tuberculins, RT23 (Statens Serum Institute, Copenhagen) and IC-65 (Cantacuzino Institute, Bucharest) when administered to 89 children with confirmed tuberculosis, admitted to Paediatric Department of Pneumophtysiology Institute, Bucharest. Mean age of subjects was 10.4 years [SD (standard deviation) = 5.2 years; variance = 27.2], and sex distribution in the group was: 55.1% girls and 44.9% boys. Tuberculin skin tests were performed using Mantoux method simultaneously with the two tuberculins in the same concentration, 2TU (tuberculin units)/0.1 ml. RT23 skin test reactions ranged from 8 mm to 18 mm (mean = 12.8 mm, SD = 2.1 mm, variance = 4.4; median = 12.0), and IC-65 reactions ranged from 8 mm to 18 mm (mean = 13.1 mm; SD = 2.1 mm; variance = 4.3; median = 13.0). The mean difference in paired reaction sizes for the two reagents was 0.04 mm and was not statistically different from zero (P value = 0.3). The difference in reaction sizes was = 2 mm in 70.8% and = 5 mm in 7.9% patients. With a cutoff of 10 mm to define a positive reaction, the results were highly correlated with a sensitivity of 98.9% for RT23 and 97.8% for IC-65. No statistically significant difference was established for the efficacy of the two commercially available PPD TST reagents, both tuberculins appearing to have equivalent potency.