The NCI-N87 cell line as a gastric epithelial barrier model for drug permeability assay

The objective of this study was to evaluate the human NCI-N87 cell line as a model for gastric permeability drug studies under pH conditions of the stomach. The optimal conditions that led NCI-N87 cells to form a typical differentiated gastric epithelial barrier were a seeding density of 2.5 × 10⁵ cells/cm² on porous inserts and growth in serum-complemented RPMI-1640 medium until 18–27 days post-confluency. The resulting cell monolayers showed moderately high transepithelial electrical resistance (TEER) values of about 500 Ω cm², cells of polygonal morphology expressing E-cadherin and ZO-1 proteins at their contact surfaces, and production of mucus clusters. The monolayers withstood apical pH of 7.4 down to 3.0 with the basal pH fixed at 7.4. The apparent permeability coefficients (P_app) of model compounds were evaluated in the apical-to-basolateral and basolateral-to-apical directions under different pH gradients. The monolayers were impermeable to the integrity marker Lucifer Yellow (low P_app of 0.3–1.1 × 10⁻⁶ cm/s). The furosemide P_app (0.4–1.5 × 10⁻⁵ cm/s) were slightly dependent on pH but remained moderate. The caffeine P_app (4.2–5.0 × 10⁻⁵ cm/s) were higher and insensitive to pH changes. The NCI-N87 cell line provides a useful in vitro tool to assess gastric drug permeability and absorption under physiologic conditions prevailing in the human stomach.     

Anisotropic elastic bending models of DNA

Simplified elastic rod models of DNA were developed in which the rigidity of DNA is sequence dependent and asymmetrical, i.e. the bending is facilitated towards the major groove. By subjecting the models to bending load in various directions perpendicular to the longitudinal axis of DNA, the bending deformation and the average conformation of the models can be estimated using finite element methods. Intrinsically curved sequence motifs [(aaaattttgc)_n, (tctctaaaaaatatataaaaa)_n] are found to be curved by this modelling procedure whereas the average conformation of homopolymers and straight motifs [(a)_n, (atctaatctaacacaacaca)_n] show negligible or no curvature. This suggests that sequence dependent asymmetric rigidity of DNA can provide an explanation in itself for intrinsic DNA curvature. The average rigidity of various DNA sequences was calculated and a good correlation was found with such quantities as the free energy change upon the binding of the Cro repressor, the base stacking energy and the thermal fluctuations at room temperature.     

IgG4 autoantibodies induce dermal-epidermal separation

Bullous pemphigoid (BP) is a sub-epidermal autoimmune blistering disease associated with autoantibodies to the dermal-epidermal junction (DEJ). Patients' autoantibodies induce dermal-epidermal separation when co-incubated with cryosections of human skin and leucocytes from healthy volunteers. IgG autoantibodies trigger complement and/or leucocyte activation resulting in specific pathology in several autoimmune conditions. In these diseases, IgG1 and IgG3 isotypes, but not the IgG4 subclass, are thought to trigger inflammatory pathways resulting in tissue damage. The capacity of IgG4 autoantibodies to mediate tissue damage has not yet been demonstrated. In this study, we isolated IgG1 and IgG4 autoantibodies from bullous pemhigoid patients'serum and analysed their blister-inducing potential in our cryosection assay. As expected, complement-fixing IgG1 autoantibodies induced sub-epidermal splits in this experimental model. Purified IgG4 did not fix complement, but, interestingly, like IgG1, activated leucocytes and induced dermal-epidermal separation. The potential of IgG4 autoantibodies to induce Fc-dependent dermal-epidermal separation was significantly lower compared to IgG1. Our results demonstrate that IgG4 autoantibodies are able to activate leucocytes and point to a hitherto less recognized function of IgG4. Moreover, for the first time, we clearly demonstrate that BP IgG4 autoantibodies have the capacity to induce leucocyte-dependent tissue damage.     

Metal selectivity determinants in a family of transition metal transporters

Metal tolerance proteins (MTPs) are plant members of the cation diffusion facilitator (CDF) transporter family involved in cellular metal homeostasis. Members of the CDF family are ubiquitously found in all living entities and show principal selectivity for Zn(2+), Mn(2+), and Fe(2+). Little is known regarding metal selectivity determinants of CDFs. We identified a novel cereal member of CDFs in barley, termed HvMTP1, that localizes to the vacuolar membrane. Unlike its close relative AtMTP1, which is highly selective for Zn(2+), HvMTP1 exhibits selectivity for both Zn(2+) and Co(2+) as assessed by its ability to suppress yeast mutant phenotypes for both metals. Expression of HvMTP1/AtMTP1 chimeras in yeast revealed a five-residue sequence within the AtMTP1 N-segment of the His-rich intracytoplasmic loop that confines specificity to Zn(2+). Furthermore, mutants of AtMTP1 generated through random mutagenesis revealed residues embedded within transmembrane domain 3 that additionally specify the high degree of Zn(2+) selectivity. We propose that the His-rich loop, which might play a role as a zinc chaperone, determines the identity of the metal ions that are transported. The residues within transmembrane domain 3 can also influence metal selectivity, possibly through conformational changes induced at the cation transport site located within the membrane or at the cytoplasmic C-terminal domain.     

Microbial community succession during lactate amendment and electron acceptor limitation reveals a predominance of metal-reducing Pelosinus spp

The determination of the success of in situ bioremediation strategies is complex. By using controlled laboratory conditions, the influence of individual variables, such as U(VI), Cr(VI), and electron donors and acceptors on community structure, dynamics, and the metal-reducing potential can be studied. Triplicate anaerobic, continuous-flow reactors were inoculated with Cr(VI)-contaminated groundwater from the Hanford, WA, 100-H area, amended with lactate, and incubated for 95 days to obtain stable, enriched communities. The reactors were kept anaerobic with N(2) gas (9 ml/min) flushing the headspace and were fed a defined medium amended with 30 mM lactate and 0.05 mM sulfate with a 48-h generation time. The resultant diversity decreased from 63 genera within 12 phyla to 11 bacterial genera (from 3 phyla) and 2 archaeal genera (from 1 phylum). Final communities were dominated by Pelosinus spp. and to a lesser degree, Acetobacterium spp., with low levels of other organisms, including methanogens. Four new strains of Pelosinus were isolated, with 3 strains being capable of Cr(VI) reduction while one also reduced U(VI). Under limited sulfate, it appeared that the sulfate reducers, including Desulfovibrio spp., were outcompeted. These results suggest that during times of electron acceptor limitation in situ, organisms such as Pelosinus spp. may outcompete the more-well-studied organisms while maintaining overall metal reduction rates and extents. Finally, lab-scale simulations can test new strategies on a smaller scale while facilitating community member isolation, so that a deeper understanding of community metabolism can be revealed.     

New opportunities revealed by biotechnological explorations of extremophiles

Over the past few decades the extremes at which life thrives has continued to challenge our understanding of biochemistry, biology and evolution. As more new extremophiles are brought into laboratory culture, they have provided a multitude of potential applications for biotechnology. More recently, innovative culturing approaches, environmental genome sequencing and whole genome sequencing have provided new opportunities for the biotechnological exploration of extremophiles.     

Comparative study of RT23 and IC-65 tuberculins tested on children with tuberculosis

This study, conducted in 2009, proposed to evaluate and compare the biological potency of two different tuberculins, RT23 (Statens Serum Institute, Copenhagen) and IC-65 (Cantacuzino Institute, Bucharest) when administered to 89 children with confirmed tuberculosis, admitted to Paediatric Department of Pneumophtysiology Institute, Bucharest. Mean age of subjects was 10.4 years [SD (standard deviation) = 5.2 years; variance = 27.2], and sex distribution in the group was: 55.1% girls and 44.9% boys. Tuberculin skin tests were performed using Mantoux method simultaneously with the two tuberculins in the same concentration, 2TU (tuberculin units)/0.1 ml. RT23 skin test reactions ranged from 8 mm to 18 mm (mean = 12.8 mm, SD = 2.1 mm, variance = 4.4; median = 12.0), and IC-65 reactions ranged from 8 mm to 18 mm (mean = 13.1 mm; SD = 2.1 mm; variance = 4.3; median = 13.0). The mean difference in paired reaction sizes for the two reagents was 0.04 mm and was not statistically different from zero (P value = 0.3). The difference in reaction sizes was = 2 mm in 70.8% and = 5 mm in 7.9% patients. With a cutoff of 10 mm to define a positive reaction, the results were highly correlated with a sensitivity of 98.9% for RT23 and 97.8% for IC-65. No statistically significant difference was established for the efficacy of the two commercially available PPD TST reagents, both tuberculins appearing to have equivalent potency.