Role of Humoral Antibodies in Resistance to Mycoplasma pneumoniae Pneumonia in Hamsters

Golden Syrian hamsters adoptively immunized with hyperimmune Mycoplasma pneumoniae rabbit antiserum, immunoglobulin (Ig) M-rich (IgM) fraction, IgG-rich (IgG) fraction, antiserum absorbed with either killed M. pneumoniae or killed Staphylococcus aureus organisms, or antiserum treated with 2-mercaptoethanol (2-ME) were examined for resistance against aerosol infection with virulent M. pneumoniae. Significant resistance to the establishment of infection in the respiratory tract was shown in hamsters pretreated with the untreated antiserum, IgG fraction or 2-ME-treated antiserum, whereas animals pretreated with the IgM fraction and the antisera absorbed with M. pneumoniae or S. aureus organisms were not significantly resistant. Histopathologically, lung lesions were markedly suppressed in animals with high resistance, but were typically pneumonic in animals with low or no resistance. The efficacy of adoptively administered serum preparations was closely related to their antibody titers. The results indicate that humoral antibody plays an important role in protection against experimental M. pneumoniae pneumonia in hamsters, although the participation of the cell-mediated immune response was not determined.     

Microbial community analysis of a coastal hot spring in Kagoshima, Japan, using molecular- and culture-based approaches

Ibusuki hot spring is located on the coastline of Kagoshima Bay, Japan. The hot spring water is characterized by high salinity, high temperature, and neutral pH. The hot spring is covered by the sea during high tide, which leads to severe fluctuations in several environmental variables. A combination of molecular- and culture-based techniques was used to determine the bacterial and archaeal diversity of the hot spring. A total of 48 thermophilic bacterial strains were isolated from two sites (Site 1: 55.6°C; Site 2: 83.1°C) and they were categorized into six groups based on their 16S rRNA gene sequence similarity. Two groups (including 32 isolates) demonstrated low sequence similarity with published species, suggesting that they might represent novel taxa. The 148 clones from the Site 1 bacterial library included 76 operational taxonomy units (OTUs; 97% threshold), while 132 clones from the Site 2 bacterial library included 31 OTUs. Proteobacteria, Bacteroidetes, and Firmicutes were frequently detected in both clone libraries. The clones were related to thermophilic, mesophilic and psychrophilic bacteria. Approximately half of the sequences in bacterial clone libraries shared <92% sequence similarity with their closest sequences in a public database, suggesting that the Ibusuki hot spring may harbor a unique and novel bacterial community. By contrast, 77 clones from the Site 2 archaeal library contained only three OTUs, most of which were affiliated with Thaumarchaeota.     

Zygosity Determination in Hairless Mice by PCR Based on Hrhr Gene Analysis

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr^hr allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr^hr in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr^hr allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr^hr (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr^hr gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.     

Role of the KcsA channel cytoplasmic domain in pH-dependent gating

The KcsA channel is a representative potassium channel that is activated by changes in pH. Previous studies suggested that the region that senses pH is entirely within its transmembrane segments. However, we recently revealed that the cytoplasmic domain also has an important role, because its conformation was observed to change dramatically in response to pH changes. Here, to investigate the effects of the cytoplasmic domain on pH-dependent gating, we made a chimera mutant channel consisting of the cytoplasmic domain of the KcsA channel and the transmembrane region of the MthK channel. The chimera showed a pH dependency similar to that of KcsA, indicating that the cytoplasmic domain can act as a pH sensor. To identify how this region detects pH, we substituted certain cytoplasmic domain amino acids that are normally negatively charged at pH 7 for neutral ones in the KcsA channels. These mutants opened independently of pH, suggesting that electrostatic charges have a major role in the cytoplasmic domain's ability to sense and respond to pH.     

Establishment and characterization of METON myoepithelioma cell line derived from human palatal myoepithelioma: apical reference to the diverse differentiation potential

Myoepithelioma is an extremely rare condition that accounts for 1–1.5 % of salivary gland tumors. It was formerly regarded as a subtype of pleomorphic adenoma, in which myoepithelial structural components predominated, but was listed as a separate disease entity in the 1991 World Health Organization classification (Seifert in Histological typing of salivary gland tumours. Springer, Berlin, 1991). Its histology is highly varied and recurrence is frequent (El-Naggar et al. in J Larygol Otol 103:1192–1197, 1989), with cases of malignant transformation having been reported (Seifert in Histological typing of salivary gland tumours. Springer, Berlin, 1991; Barnes et al. in Pathology and Genetics of head and neck tumours. IARC Press, Lyon, 2005), making this a difficult tumor to control in many cases. This is thought to be due to the multiple differentiation potential of myoepithelial cells, but the details are unknown. There have been a number of reports of the establishment of cell lines (Shirasuna et al. Cancer. 45:297–305, 1980; Jaeger et al. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 84:663–667, 1997), but numerous points remain unclear. We established a myoepithelial cell line designated METON, and investigated its characteristics. METON consists of cells with two different morphologies: spindle-shaped cells and epithelial-like cells. Then. we also used single-cell cloning method to establish various subclones (epithelial-like, spindle-like, and mixed epithelial-like/spindle-like cell lines). Among these, pluripotency markers were expressed by the mixed epithelial-like/spindle-like cell lines. The newly established cell line expressing these pluripotency markers will be extremely useful for elucidating the diverse histologies of salivary gland tumors.