Elucidation of the speciation history of three sister species of crown-of-thorns starfish (Acanthaster spp.) based on genomic analysis

The crown-of-thorns starfish (COTS) is a coral predator that is widely distributed in Indo-Pacific Oceans. A previous phylogenetic study using partial mitochondrial sequences suggested that COTS had diverged into four distinct species, but a nuclear genome-based analysis to confirm this was not conducted. To address this, COTS species nuclear genome sequences were analysed here, sequencing Northern Indian Ocean (NIO) and Red Sea (RS) species genomes for the first time, followed by a comparative analysis with the Pacific Ocean (PO) species. Phylogenetic analysis and ADMIXTURE analysis revealed clear divergences between the three COTS species. Furthermore, within the PO species, the phylogenetic position of the Hawaiian sample was further away from the other Pacific-derived samples than expected based on the mitochondrial data, suggesting that it may be a PO subspecies. The pairwise sequentially Markovian coalescent model showed that the trajectories of the population size diverged by region during the Mid-Pleistocene transition when the sea-level was dramatically decreased, strongly suggesting that the three COTS species experienced allopatric speciation. Analysis of the orthologues indicated that there were remarkable genes with species-specific positive selection in the genomes of the PO and RS species, which suggested that there may be local adaptations in the COTS species.     

Fluorescence resonance energy transfer between points on actin and the C-terminal region of tropomyosin in skeletal muscle thin filaments

Fluorescence resonance energy transfer between points on tropomyosin (positions 87 and 190) and actin (Gln-41, Lys-61, Cys-374, and the ATP-binding site) showed no positional change of tropomyosin relative to actin on the thin filament in response to changes in Ca2+ concentration (Miki et al. (1998) J. Biochem. 123, 1104-1111). This is consistent with recent electron cryo-microscopy analysis, which showed that the C-terminal one-third of tropomyosin shifted significantly towards the outer domain of actin, while the N-terminal half of tropomyosin shifted only a little (Narita et al. (2001) J. Mol. Biol. 308, 241-261). In order to detect any significant positional change of the C-terminal region of tropomyosin relative to actin, we generated mutant tropomyosin molecules with a unique cysteine residue at position 237, 245, 247, or 252 in the C-terminal region. The energy donor probe was attached to these positions on tropomyosin and the acceptor probe was attached to Cys-374 or Gln-41 of actin. These probe-labeled mutant tropomyosin molecules retain the ability to regulate the acto-S1 ATPase activity in conjunction with troponin and Ca2+. Fluorescence resonance energy transfer between these points of tropomyosin and actin showed a high transfer efficiency, which should be very sensitive to changes in distance between probes attached to actin and tropomyosin. However, the transfer efficiency did not change appreciably upon removal of Ca2+ ions, suggesting that the C-terminal region of tropomyosin did not shift significantly relative to actin on the reconstituted thin filament in response to the change of Ca2+ concentration.     

Simple RNAi vectors for stable and transient suppression of gene function in rice

Since the recent sequencing of the rice genome, the functional identification of rice genes has become increasingly important. Various tagged lines have been generated; however, the number of tagged genes available is not sufficient for extensive study of gene function. To help identify the functions of genes in rice, we developed a Gateway vector, pANDA, for RNA interference of rice genes. This vector can be used for Agrobacterium transformation of rice and allows easy and fast construction of efficient RNAi vectors. In the construct, hairpin RNA derived from a given gene is transcribed from a strong maize ubiquitin promoter, and an intron is placed 5' upstream of inverted repeats to enhance RNA expression. Analysis of rice genes using this vector showed that suppression of mRNA expression was observed in more than 90% of transgenic plants examined, and short interfering RNA indicative of RNA silencing was detected in each silenced plant. A similar vector, pANDA-mini, was also developed for direct transfer into leaf cells or protoplasts. This vector can be used for transient suppression of gene function in rice. These vectors should help identify the functions of rice genes whose tagged mutants are not available at present and complement existing methods for functional genomics of rice.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Imiquimod Suppresses Propagation of Herpes Simplex Virus 1 by Upregulation of Cystatin A via the Adenosine Receptor A1 Pathway

Imiquimod is recognized as an agonist for Toll-like receptor 7 (TLR7) in immunocompetent cells. TLR7, as well as TLR3 and TLR8, triggers the immune responses, such as the production of type I interferons (IFNs) and proinflammatory cytokines via recognition of viral nucleic acids in the infected cells. In this study, we proposed that imiquimod has an IFN-independent antiviral effect in nonimmune cells. Imiquimod, but not resiquimod, suppressed replication of human herpes simplex virus 1 (HSV-1) in FL cells. We analyzed alternation of gene expression by treatment with imiquimod using microarray analysis. Neither type I IFNs, nor TLRs, nor IFN-inducible antiviral genes were induced in imiquimod-treated FL cells. Cystatin A, a host cysteine protease inhibitor, was strongly upregulated by imiquimod and took a major part in the anti-HSV-1 activity deduced by the suppression experiment using its small interfering RNA. Upregulation of cystatin A was suggested to be mediated by antagonizing adenosine receptor A(1) and activating the protein kinase A pathway. Imiquimod, but not resiquimod, was shown to interact with adenosine receptor A(1). Imiquimod-induced anti-HSV-1 activity was observed in other cells, such as HeLa, SiHa, and CaSki cells, in a manner consistent with the cystatin A induction by imiquimod. These results indicated that imiquimod acted as an antagonist for adenosine receptor A(1) and induced a host antiviral protein, cystatin A. The process occurred independently of TLR7 and type I IFNs.     

Progress in the 21st century: a Roadmap for the Ecological Society of Japan

The primary goal of the 60th anniversary symposium of the Ecological Society of Japan (ESJ) was to re-examine the role of the Society. The first of five lectures, “Development of Long-term Ecological Research in Japan,” discussed the increasingly important role of long-term and networked research studies. Ecological research in Asia faces many challenges, because Asia features natural and anthropogenic landscapes with highly diverse ecosystems. “Developing Strategies of the Ecological Society of Japan for Worldwide Societies of Ecology with Special Reference to Strategies for Asia” emphasized the role of ESJ in promoting ecological research and outreach in Asia. Ecosystem sustainability is a key issue in both the theory and practice of ecosystem management. A framework concept of an environmental and biodiversity cycle was proposed in the session “Linking Community and Ecosystem Dynamics” for understanding the mechanisms driving the sustainability of ecosystems. Ecosystem services are essential aspects of land use and conservation planning and management. “Integrating Models of Ecosystem Services and Land Use Changes” reviewed recently-developed models that simulate patterns of land-use change and analyze its effects on ecosystem services and also recommended future directions for collaboration among researchers. “Disaster Resilience and Coastal Ecology” highlighted the contributions of ecologists to evaluating the resilience of damaged coastal ecosystems and provided sound proposals to local communities and governments for rehabilitation plans. The past achievements and future directions of ESJ were discussed by the panelists and the audience in “Past and Future of the Ecological Society of Japan.”     

Distinct Disease Phases in Muscles of Facioscapulohumeral Dystrophy Patients Identified by MR Detected Fat Infiltration

Facioscapulohumeral muscular dystrophy (FSHD) is an untreatable disease, characterized by asymmetric progressive weakness of skeletal muscle with fatty infiltration. Although the main genetic defect has been uncovered, the downstream mechanisms causing FSHD are not understood. The objective of this study was to determine natural disease state and progression in muscles of FSHD patients and to establish diagnostic biomarkers by quantitative MRI of fat infiltration and phosphorylated metabolites. MRI was performed at 3T with dedicated coils on legs of 41 patients (28 men/13 women, age 34–76 years), of which eleven were re-examined after four months of usual care. Muscular fat fraction was determined with multi spin-echo and T1 weighted MRI, edema by TIRM and phosphorylated metabolites by 3D ³¹P MR spectroscopic imaging. Fat fractions were compared to clinical severity, muscle force, age, edema and phosphocreatine (PCr)/ATP. Longitudinal intramuscular fat fraction variation was analyzed by linear regression. Increased intramuscular fat correlated with age (p<0.05), FSHD severity score (p<0.0001), inversely with muscle strength (p<0.0001), and also occurred sub-clinically. Muscles were nearly dichotomously divided in those with high and with low fat fraction, with only 13% having an intermediate fat fraction. The intramuscular fat fraction along the muscle’s length, increased from proximal to distal. This fat gradient was the steepest for intermediate fat infiltrated muscles (0.07±0.01/cm, p<0.001). Leg muscles in this intermediate phase showed a decreased PCr/ATP (p<0.05) and the fastest increase in fatty infiltration over time (0.18±0.15/year, p<0.001), which correlated with initial edema (p<0.01), if present. Thus, in the MR assessment of fat infiltration as biomarker for diseased muscles, the intramuscular fat distribution needs to be taken into account. Our results indicate that healthy individual leg muscles become diseased by entering a progressive phase with distal fat infiltration and altered energy metabolite levels. Fat replacement then relatively rapidly spreads over the whole muscle.     

Evaluation of acid‐labile S‐protecting groups to prevent Cys racemization in Fmoc solid‐phase peptide synthesis

Phosphonium and uronium salt‐based reagents enable efficient and effective coupling reactions and are indispensable in peptide chemistry, especially in machine‐assisted SPPS. However, after the activating and coupling steps with these reagents in the presence of tertiary amines, Fmoc derivatives of Cys are known to be considerably racemized during their incorporation. To avoid this side reaction, a coupling method mediated by phosphonium/uronium reagents with a weaker base, such as 2,4,6‐trimethylpyridine, than the ordinarily used DIEA or that by carbodiimide has been recommended. However, these methods are appreciably inferior to the standard protocol applied for SPPS, that is, a 1 min preactivation procedure of coupling with phosphonium or uronium reagents/DIEA in DMF, in terms of coupling efficiency, and also the former method cannot reduce racemization of Cys(Trt) to an acceptable level (<1.0%) even when the preactivation procedure is omitted. Here, the 4,4′‐dimethoxydiphenylmethyl and 4‐methoxybenzyloxymethyl groups were demonstrated to be acid‐labile S‐protecting groups that can suppress racemization of Cys to an acceptable level (<1.0%) when the respective Fmoc derivatives are incorporated via the standard SPPS protocol of phosphonium or uronium reagents with the aid of DIEA in DMF. Furthermore, these protecting groups significantly reduced the rate of racemization compared to the Trt group even in the case of microwave‐assisted SPPS performed at a high temperature. © 2013 The Authors. European Peptide Society published by John Wiley & Sons, Ltd.