cis-4-Hydroxy-L-proline and ethyl-3,4-dihydroxybenzoate prevent myogenesis of C2C12 muscle cells and block MyoD1 and myogenin expression.

cis-4-Hydroxy-L-proline (cis-OH-Pro) and ethyl-3,4-dihydroxybenzoate (EDHB), two distinct inhibitors of collagen synthesis, prevented myogenesis in C2C12 mouse skeletal muscle cells. Both inhibitors blocked myotube formation and the expression of sarcomeric myosin heavy chain. Northern blot analysis showed that cis-OH-Pro- and EDHB-treated C2C12 muscle cells did not express the myogenic regulatory genes, MyoD1 and myogenin, but continued to express non-muscle isoforms of actin (beta and gamma) and alpha-tropomyosin. 10TFL2-3B cells, a C3H10T1/2 cell line permanently transfected with myogenin cDNA, constitutively expressed exogenous myogenin in the presence of cis-OH-Pro but failed to activate endogenous myogenin and to undergo myogenesis. These results demonstrate that commitment to terminal differentiation and activation of myogenic regulatory genes requires active synthesis of the extracellular matrix component collagen.     

EPR signals of cytochrome b558 purified from porcine neutrophils.

Cytochrome b558 of pig blood neutrophils was partially purified, and its EPR spectra were measured. The cytochrome b558 was solubilized from membranes with the detergent n-heptyl-beta-thioglucoside and purified by DEAE-Sepharose and heparin-Sepharose chromatographies. The small and large subunits of cytochrome b558 were detected on gel by immunoblotting. A solution of the purified, undenatured cytochrome b558 at 85-108 microM concentration was obtained. The concentrated cytochrome b558 showed an EPR signal at a g value of 3.26 with a bandwidth of 100 G at 10 K. Addition of 2 mM KCN had no effect on the low spin signal at g = 3.26 but caused disappearance of a minor high spin signal. The cyanide-insensitive signal at g = 3.26 disappeared completely on reduction with Na2S2O4. These results suggest that the g = 3.26 signal is characteristic of the low spin heme in cytochrome b558 of neutrophils.     

Expression of human soluble tissue factor in yeast and enzymatic properties of its complex with factor VIIa.

The extracellular domain of human tissue factor (TF, amino acids 1-217) was expressed in Saccharomyces cerevisiae, using the inducible yeast acid phosphatase promoter and the yeast invertase signal sequence to direct its secretion into the culture broth. Two active soluble forms sTF alpha (high molecular weight form) and sTF beta (low molecular weight form) were purified, the yield being approximately 10 and 1 mg/liter of culture supernatant, respectively. sTF alpha had an apparent molecular mass of 150 kDa on SDS-polyacrylamide gel electrophoresis and contained more than 200 residues of mannose/mol of protein. sTF beta had an apparent molecular mass of 37 kDa and contained 22 residues of mannose/mol of protein. N-Glycosidase F treatments of both rTFs reduced the apparent molecular mass to 35 kDa. The amino-terminal sequences and amino acid compositions of sTF alpha and sTF beta were consistent with those deduced from the cDNA sequence, thereby indicating that the difference in molecular mass is caused by heterogeneity of oligosaccharide structures. Of these recombinant TFs, sTF beta enhanced factor VIIa-amidolytic activity 40-fold toward the chromogenic substrate and 147-fold toward the fluorogenic substrate, affecting mainly the kcat value. The enhancement was comparable with that of TF purified from human placenta. The TF-mediated enhancement of factor VIIa-amidolytic activity was inhibited by heparin-activated antithrombin III, forming a high molecular weight complex. As treatment of sTF beta with denaturants such as guanidine hydrochloride or urea led to a biphasic loss of the activity, the extracellular domain of TF probably consists of two discrete domains. This expression system provides a significant amount of the extracellular domain of TF so that studies of interactions with factor VII are feasible.     

The effect of alpha-tocopherol as an antioxidant on the oxidation of membrane protein thiols induced by free radicals generated in different sites

Azo compounds enable us to generate peroxyl radicals by thermal decomposition at a constant rate and at a desired site, that is, water-soluble compounds produce initiating radicals in an aqueous phase and lipid-soluble compounds initiate the oxidation within the membrane-lipid layer. Using these radicals generated in different sites, we oxidized red blood cell ghost membranes to study the relationships between alpha-tocopherol depletion, initiation of lipid peroxidation, and protein damage. When radicals were generated in the aqueous phase, the loss of membrane protein thiols was observed concurrently with the consumption of membrane tocopherol and after tocopherol was exhausted the peroxidation of membrane lipids occurred. On the other hand, when radicals were initiated within the lipid region, the oxidation of thiols and the formation of thiobarbituric acid-reactive substances were suppressed to give an induction period until tocopherol fell below a critical level. Our results indicate that the surface thiols of extrinsic proteins may compete with alpha-tocopherol for trapping aqueous radicals and spare tocopherol to some extent, whereas the oxidation of intrinsic buried thiols may commence due to lipid-derived radicals produced after tocopherol was consumed. In conclusion, alpha-tocopherol in the membrane can break the free radical chain efficiently to inhibit the lipid peroxidation. However, the effect of tocopherol on the inhibition of membrane protein damage, exhibited by the loss of thiols and the formation of high-molecular-weight proteins, would be different depending on the site of initial radical generation.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Effect of dehydration on thirst and drinking during immersion in men.

The mechanism for reduced voluntary water intake during water immersion was studied in eight men (19-25 yr of age) immersed to the neck while sitting for 3 h at 34.5 degrees C or in air at 28 degrees C when euhydrated (Eu-H2O and Eu-air, respectively) and hypohydrated (Hypo-H2O and Hypo-air) by 3.6% body weight loss. Thirst sensations (degree of thirst, mouth dryness and taste, drinking desirability, and stomach fullness) were similar at the beginning of Hypo-air and Hypo-H2O test periods. Initial drinking of tap water (15 degrees C) was 216 +/- 30 ml/7 min (P less than 0.05) with Hypo-air, decreased to 108 +/- 28 ml/7 min (P less than 0.05) with Hypo-H2O, and was 10-50 ml/10-30 min thereafter. Intake was less than 10 ml/10-30 min in Eu-air, and there was no drinking in Eu-H2O. Within the first 10 min of immersion, compared with Hypo-air findings, the significant reduction in drinking in the Hypo-H2O experiment was associated with unchanged plasma Na+, plasma osmolality, heart rates, and mean arterial pressures; the different responses were increased cardiac output, plasma volume, and atrial natriuretic peptides and decreased plasma renin activity and arginine vasopressin. Thus the extracellular pathway, as opposed to the osmotic pathway, appears to be the major mechanism for immersion-induced suppression of drinking.     

Structural studies of rat cathepsin E: amino-terminal structure and carbohydrate units of mature enzyme

The amino-terminal structure of rat gastric cathepsin E was identified and compared with the corresponding regions of human procathepsin E and other aspartic proteinases. The alignment revealed that cathepsin E has the most extended amino-terminal structure in aspartic proteinases, thus suggesting that the activation peptide (propeptide) of the human enzyme is 39-residues long. Analysis of oligosaccharide units suggested that rat cathepsin E possesses one N-linked carbohydrate unit, probably of the high mannose type. No evidence was obtained for the presence of O-linked sugars in rat cathepsin E.