The nature of virus strains isolated from patients with poliomyelitis in the Byelorussian SSR 1967-1985

Oligonucleotide mapping of the RNA genome was applied for analysis of poliovirus clinical isolates in Byelorussia in 1967-1985. All the maps have been clearly shown to resemble the reference maps of the corresponding vaccine strains. Examination of the oligonucleotide maps of poliovirus isolates provides a measure of distribution of some of the mutations over the viral genome.     

Coimmobilization of D-amino acid oxidase and catalase by entrapment ofTrigonopsis variabilis in radiation polymerised Polyacrylamide beads

Trigonopsis variabilis induced for D-amino acid oxidase and catalase was immobilized by entrapment in Polyacrylamide beads obtained by radiation polymerisation. Permeabilization of the cells was found to be essential for optimal activity of the enzymes in free cells. However, the process of entrapment itself was found to eliminate the permeability barrier of cells immobilized in Polyacrylamide. The two enzymes exhibited a differential response on Polyacrylamide entrapment. Thus, D-amino acid oxidase activity was stabilized to heat inactivation whereas catalase in the same cells showed a destabilization on entrapment in Polyacrylamide. The coimmobilized enzyme preparation showed an operational half life of 7–9 days after which the D-amino acid oxidase activity remained stable at a value 35–40% of that of the initial activity for a study period of 3 weeks. Coimmobilization of MnO₂ was not effective in enhancing the operational life of the enzyme preparation.     

A sensitive high performance liquid chromatographic method for determining small amounts of glycosylproteins

We developed a simple isocratic high performance liquid chromatography (HPLC) method for the quantitative determination of 5-hydroxymethyl-2-furfuraldehyde (5-HMF) liberated by mild hydrolysis of small amounts of glycosyl proteins. The absorbance of hydrolysate components after HPLC separation was recorded at 280 nm. To detect substances possibly interfering with the 5-HMF peak we always recorded the ratio of the peak heights A280 nm/A254 nm which was a constant value of 4.4. For each sample the blank was obtained by reduction with NaBH4 before hydrolysis with oxalic acid 1 mol/l. The best NaBH4/protein ratio was found to be 4 mg/mg. With this method we measured the nonenzymatic glycosylation (glycation) as 5-HMF in samples with a protein concentration as low as 0.8 mg/ml. 5-HMF produced per milligram of protein was independent from protein concentration for a wide range (0.8-10 mg/ml). The mean coefficient of variation for within assay and between precision was 6.8 and 11.6%, respectively. The 5-HMF measured on plasma proteins from normal subjects (n = 7) was 0.16 +/- 0.04 nmol/mg. Protein from insulin-dependent diabetic patients was 0.31 +/- 0.07 nmol/mg. With this method we succeeded in detecting an excessive glycation of platelet membrane proteins in 13 type-I diabetic patients.     

Inhibition of human natural killer activity by monolayers of primary cell cultures

Some primary and continuous cell cultures were tested for their capacity to regulate human natural killer (NK) activity. Primary cultures of endothelial cells, fetal fibroblasts, adult fibroblasts, amnion epithelial cells, renal parenchymal cells, and ovarian carcinoma cells inhibited NK activity when peripheral blood lymphocytes were preincubated on target cell monolayers for 18 h before testing the cytotoxicity against K-562. The supernatants of the inhibiting cell cultures were not suppressive. Prostaglandins or suppressive lymphocytes were not involved in the phenomenon. The binding capacity of the effector cells was not changed, suggesting that the suppressive signal was targeted at the cytolytic machinery of NK cells. The down-regulating capacity of the cell cultures weakened significantly during subculturing in vitro, and continuous cell lines were not inhibitory. The inactivation of NK cells may be one of the mechanisms by which target cells are protected from NK activity.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

The crystal structure of the beta-lactamase of Streptomyces albus G at 0.3 nm resolution.

The crystal structure of the beta-lactamase of Streptomyces albus G has been solved at 0.3 nm resolution by X-ray-diffraction methods. The enzyme is a typical two-domain protein. One domain consists of five alpha-helices, and the other is five-stranded beta-sheet with alpha-helices on both sides of the sheet. The active-site serine residue (Ser-48) is within a cleft located between the two domains.     

Influence of the gut microflora on protein synthesis in tissues and in the whole body of chicks.

1. The influence of the gut microflora on protein synthesis in individual tissues and in the whole body of young chicks was investigated by the large-dose injection of [3H]phenylalanine. 2. Growth of germ-free chicks was significantly better than that of conventional controls. Wet weights of liver, spleen, duodenum, jejunum + ileum and caeca were heavier in conventional birds than in germ-free counterparts. 3. Fractional rates of protein synthesis were higher in jejunum + ileum and whole body of conventional birds than in those of germ-free birds. Amounts of protein synthesized were larger in liver, jejunum + ileum and caeca in the presence of the gut microflora. 4. When tissues were classified into gut + liver and the remainder of the carcass, in the presence of the gut microflora an enhanced protein synthesis in fractional and absolute rate was found in the gut + liver, which is in direct contact or in close association with micro-organisms, whereas virtually no effect of the gut micro-organisms was detected in the remainder of the carcass. 5. The contribution of protein synthesis of gut + liver to that of the whole body was larger in conventional chicks than in germ-free birds, whereas the reverse was true for the remainder of the carcass.     

Action of hypochlorous acid on the antioxidant protective enzymes superoxide dismutase, catalase and glutathione peroxidase.

The neutrophil enzyme myeloperoxidase generates hypochlorous acid (HOCl) at sites of inflammation. Glutathione peroxidase is very quickly inactivated by low concentration of HOCl. Inactivation of catalase is also rapid, but requires higher HOCl concentrations and the haem appears to be degraded. Inactivation of bovine CuZn superoxide dismutase is slower. Hence superoxide dismutase should not be easily inactivated by HOCl at sites of inflammation, which may contribute to its effectiveness as an anti-inflammatory agent and in minimizing reperfusion injury.