Production of the Mycotoxin Fumonisin B(1) by Alternaria alternata f. sp. lycopersici

The mycotoxin fumonisin B(1), originally described as being produced by Fusarium moniliforme, was detected in liquid cultures of Alternaria alternata f. sp. lycopersici, a host-specific pathogen of tomato plants. The metabolite was detected by high-pressure liquid chromatography and mass spectrometry. Its identity was confirmed by fast atom bombardment and ion spray mass spectrometry, as well as parent-daughter tandem mass spectrometry. In three separate experiments, the concentrations found ranged between 5 and 140 ppm (mug/ml).     

High-density Escherichia coli cultivation process for hyperexpression of recombinant porcine growth hormone.

Fermentation studies were performed on an Escherichia coli culture that carries a recombinant plasmid composed of an ampicillin-resistant gene, a temperature-regulated pL promoter, and a porcine pituitary cDNA sequence coding for growth hormone. The objective was to achieve high cell density while maintaining the specific expression level of recombinant porcine growth hormone (r-pGH) observed in shake flasks. At a specific expression level of 20% of total cell protein, the cell density of a glucose-limited fed-batch process reached 38 units of OD600 in 14 h, compared to flask cultivation, which resulted in only 1.4 units of OD600 in the same period. The observed critical fermentation conditions for maximal expression included (1) limiting glucose concentration below 1 g l-1 throughout the fed-batch growth and induction phases, (2) keeping postinduction temperature at 42 degrees C for 5-7 h, and (3) maintaining a postinduction growth rate around 0.17-0.21 h-1.     

The effects of large blood vessels on temperature distributions during simulated hyperthermia.

Several three-dimensional vascular models have been developed to study the effects of adding equations for large blood vessels to the traditional bioheat transfer equation of Pennes when simulating tissue temperature distributions. These vascular models include "transiting" vessels, "supplying" arteries, and "draining" veins, for all of which the mean temperature of the blood in the vessels is calculated along their lengths. For the supplying arteries this spatially variable temperature is then used as the arterial temperature in the bioheat transfer equation. The different vascular models produce significantly different locations for both the maximum tumor and the maximum normal tissue temperatures for a given power deposition pattern. However, all of the vascular models predict essentially the same cold regions in the same locations in tumors: one set at the tumors' corners and another around the inlets of the large blood vessels to the tumor. Several different power deposition patterns have been simulated in an attempt to eliminate these cold regions; uniform power in the tumor, annular power in the tumor, preheating of the blood in the vessels while they are traversing the normal tissue, and an "optimal" power pattern which combines the best features of the above approaches. Although the calculations indicate that optimal power deposition patterns (which improve the temperature distributions) exist for all of the vascular models, none of the heating patterns studied eliminated all of the cold regions. Vasodilation in the normal tissue is also simulated to see its effects on the temperature fields.(ABSTRACT TRUNCATED AT 250 WORDS)     

How various factors influence the CO2/O2 specificity of ribulose-1,5-bisphosphate carboxylase/oxygenase

Temperature, activating metal ions, and amino-acid substitutions are known to influence the CO₂/O₂ specificity of the chloroplast enzyme ribulose-1,5-bisphosphate carboxylase/oxygenase. However, an understanding of the physical basis for enzyme specificity has been elusive. We have shown that the temperature dependence of CO₂/O₂ specificity can be attributed to a difference between the free energies of activation for the carboxylation and oxygenation partial reactions. The reaction between the 2,3-enediolate of ribulose 1,5-bisphosphate and O₂ has a higher free energy of activation than the corresponding reaction of this substrate with CO₂. Thus, oxygenation is more responsive to temperature than carboxylation. We have proposed possible transition-state structures for the carboxylation and oxygenation partial reactions based upon the chemical natures of these two reactions within the active site. Electrostatic forces that stabilize the transition state of the carboxylation reaction will also inevitably stabilize the transition state of the oxygenation reaction, indicating that oxygenase activity may be unavoidable. Furthermore, the reduction in CO₂/O₂ specificity that is observed when activator Mg²⁺ is replaced by Mn²⁺ may be due to Mg²⁺ being more effective in neutralizing the negative charge of the carboxylation transition state, whereas Mn²⁺ is a transition-metal ion that can overcome the triplet character of O₂ to promote the oxygenation reaction.Abbreviations CABP 2-carboxyarabinitol 1,5-bisphosphate - enol-RuBP 2,3-enediolate of ribulose 1,5-bisphosphate - K_c K_mfor CO₂ - K_o K_mfor O₂ - Rubisco ribulose-1,5-bisphosphate carboxylase/oxygenase - RuBP ribulose 1,5-bisphosphate - V_c V _max for carboxylation - V_o V _max for oxygenation     

Control of phytoseiids in a spider mite mass-rearing system (Acari: Phytoseiidae,Tetranychidae)

Phytoseiid mites which contaminated the spider mite colony and interfered with the mass-rearing of spider mites were controlled by dipping in hot water. Immersion for 60 s in water of 50°C killed all stages ofAmblyseius fallacis (Garman),A. womersleyi Schicha andPhytoseiulus persimilis (Athias-Henriot) (Acari: Phytoseiidae). Only approximately 0.3% of theA. womersleyi eggs hatched, and this seems negligible. The populations ofTetranychus kanzawai Kishida andT. urticae (Koch) (Acari: Tetranychidae) were reduced. However, they recovered well. Although this treatment resulted in the withering of some soybean seedlings, the next trifoliate leaf to be produced was normal. A very satisfactory result was obtained when this technique was applied to the mass-rearing system.     

Calcium is required for the reduction of sulfite from hydrogen in a reconstituted electron transfer chain from the sulfate reducing bacterium, Desulfovibrio gigas

Calcium is found a strong stimulator of sulfite reduction from hydrogen. A coupling protein of molecular weight 65,000 can be isolated from Desulfovibrio gigas. It functions in a reconstituted electron transfer chain between hydrogenase and sulfite reductase. Its N-terminal sequence shows high homologies with calcium or magnesium binding sites from other calcium-binding proteins.     

Import of human bifunctional enzyme into peroxisomes of human hepatoma cells in vitro.

A polypeptide containing the carboxyl-terminal fragment of human peroxisomal enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme was synthesized in vitro from its cDNA clone. This expression polypeptide was transported into purified rat liver peroxisomes. When the expression polypeptide was incubated with postnuclear supernatant fractions of human hepatoma cells and analyzed by Nycodenz gradient SDS-PAGE and fluorography, it was imported specifically into peroxisomes as indicated by its resistance to proteinase K degradation. A deletion of the last nine amino acid residues at the carboxyl-terminus of this polypeptide prevents its peroxisomal import. A tripeptide sequence, SKL, located at the carboxyl-terminus of human bifunctional enzyme appears to be the targeting signal for the peroxisomal importation of bifunctional enzyme in human cells.     

Hairpin formation in the self-complementary dodecamer d-GGTACGCGTACC and derivatives containing GA and IA mispairs

The dodecamer d-GGTACGCGTACC and four derivatives with GA and IA mispairs in the 6,7 and 5,8 positions have been examined in dilute solution and 0.01-0.1 M sodium chloride. Concentration dependence of Tm, gel electrophoresis, and equilibrium centrifugation indicate that these self-complementary oligomers can form hairpins under the present conditions. Thermal transitions measured in the ultraviolet primarily represent melting of hairpin to coil [cf. Scheffler et al. (1968, 1970)]. The Tm values show little or no depression for 6,7 substitution but rather large depression for 5,8 replacement. We interpret the results to indicate that the 6,7 sequences have two-base loops and five base pair stems and that the 5,8 sequences have four-base loops and four base pair stems. A concurrent theoretical modeling study [Raghunathan et al. (1991) Biochemistry (following paper in this issue)] provides support for this interpretation.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)