排序方式: 共有81条查询结果,搜索用时 93 毫秒
41.
Shokrollahzadeh S Bonakdarpour B Vahabzadeh F Sanati M 《Journal of industrial microbiology & biotechnology》2007,34(1):17-25
The effect of phosphate (P
i
) concentration on the growth behavior of Saccharomyces cerevisiae strain CEN.PK113-5D in phosphate-limited batch and chemostat cultures was studied. The range of dilution rates used in the present study was 0.08–0.45 h−1. The batch growth of yeast cells followed Monod relationship, but growth of the cells in phosphate-limited chemostat showed change in growth kinetics with increasing dilution rates. The difference in growth kinetics of the yeast cells in phosphate-limited chemostat for dilution rates below and above approximately 0.2 h−1 has been discussed in terms of the batch growth kinetic data and the change in the metabolic activity of the yeast cells. Immunological detection of a C-terminally myc epitope-tagged Pho84 fusion protein indicated derepressive expression of the Pho84 high-affinity P
i
transporter in the entire range of dilution rates employed in this study. Phosphate transport activity mediated by Pho84 transporter was highest at very low dilution rates, i.e. 0.08–0.1 h−1, corresponding to conditions in which the amount of synthesized Pho84 was at its maximum. 相似文献
42.
Maryam Karamali Nabiollah Nasiri Naemeh Taghavi Shavazi Mehri Jamilian Fereshteh Bahmani Maryam Tajabadi-Ebrahimi Zatollah Asemi 《Probiotics and antimicrobial proteins》2018,10(3):496-503
Synbiotics are known to exert multiple beneficial effects, including anti-inflammatory and antioxidative actions. This study was designed to evaluate the effects of synbiotic administration on biomarkers of inflammation, oxidative stress, and pregnancy outcomes among gestational diabetic (GDM) women. This randomized, double-blind, placebo-controlled clinical trial was carried out among 60 subjects with GDM who were not on oral hypoglycemic agents. Patients were randomly assigned to consume either one synbiotic capsule containing Lactobacillus acidophilus strain T16 (IBRC-M10785), L. casei strain T2 (IBRC-M10783), and Bifidobacterium bifidum strain T1 (IBRC-M10771) (2 × 109 CFU/g each) plus 800 mg inulin (HPX) (n = 30) or placebo (n = 30) for 6 weeks. Compared with the placebo, synbiotic supplementation significantly decreased serum high-sensitivity C-reactive protein (hs-CRP) (? 1.9 ± 4.2 vs. +1.1 ± 3.5 mg/L, P = 0.004), plasma malondialdehyde (MDA) (? 0.1 ± 0.6 vs. + 0.3 ± 0.7 μmol/L, P = 0.02), and significantly increased total antioxidant capacity (TAC) (+ 70.1 ± 130.9 vs. ? 19.7 ± 124.6 mmol/L, P = 0.009) and total glutathione (GSH) levels (+ 28.7 ± 61.5 vs. ? 14.9 ± 85.3 μmol/L, P = 0.02). Supplementation with synbiotic had a significant decrease in cesarean section rate (16.7 vs. 40.0%, P = 0.04), lower incidence of hyperbilirubinemic newborns (3.3 vs. 30.0%, P = 0.006), and newborns’ hospitalization (3.3 vs. 30.0%, P = 0.006) compared with the placebo. Synbiotic supplementation did not affect plasma nitric oxide (NO) levels and other pregnancy outcomes. Overall, synbiotic supplementation among GDM women for 6 weeks had beneficial effects on serum hs-CRP, plasma TAC, GSH, and MDA; cesarean section; incidence of newborn’s hyperbilirubinemia; and newborns’ hospitalization but did not affect plasma NO levels and other pregnancy outcomes. http://www.irct.ir: www.irct.ir: IRCT201704205623N108 相似文献
43.
44.
Ahmad Mobed Parina Mehri Mohammad Hasanzadeh Ahad Mokhtarzadeh 《Journal of molecular recognition : JMR》2020,33(7)
The management of pathogen detection using a rapid and cost‐effective method presents a major challenge to the biological safety of the world. The field of pathogen detection is nascent and therefore, faces a dynamic set of challenges as the field evolves. Visceral leishmaniasis (VL), or kala‐azar is the most severe form of leishmaniasis. Delay to the accurate diagnosis and treatment is likely to lead to fatality. The reliable, fast and sensitive detection is closely linked to safe and effective treatment of Leishmania spp. Despite several routine and old method for sensitive and specificity detection of Leishmania spp, there is highly demand for developing modern and powerfully system. In this study a novel ultra‐sensitive DNA‐based biosensor was prepared for detection of Leishmania spp. For the first time, the specific and thiolated sequences of the Leishmania spp genome (5′‐SH‐[CH2]6 ATCTCGTAAGCAGATCGCTGTGTCAC‐3′) were recognized by electrochemical methods. Also, selectivity of the proposed bioassay was examined by three sequences that were mismatched in 1, 2, and 3 nucleotides. The linear range (10?6 to 10?21 M) and limit of detection (LLOQ = 1 ZM) obtained are remarkable in this study. Also, simple and cost‐effective construction of genosensors was another advantage of the proposal DNA‐based assay. The experimental results promise a fast and simple method in detection of kala‐azar patients with huge potential of the nanocomposite‐based probe for development of ideal biosensors. 相似文献
45.
Mehri Shahir Seyed Mahmoud Hashemi Ali Asadirad Mohammad Varahram Mehdi Kazempour-Dizaji Gert Folkerts Johan Garssen Ian Adcock Esmaeil Mortaz 《Journal of cellular physiology》2020,235(10):7043-7055
Dendritic cells (DCs) orchestrate innate inflammatory responses and adaptive immunity through T-cell activation via direct cell–cell interactions and/or cytokine production. Tolerogenic DCs (tolDCs) help maintain immunological tolerance through the induction of T-cell unresponsiveness or apoptosis, and generation of regulatory T cells. Mesenchymal stromal cells (MSCs) are adult multipotent cells located within the stroma of bone marrow (BM), but they can be isolated from virtually all organs. Extracellular vesicles and exosomes are released from inflammatory cells and act as messengers enabling communication between cells. To investigate the effects of MSC-derived exosomes on the induction of mouse tolDCs, murine adipose-derived MSCs were isolated from C57BL/6 mice and exosomes isolated by ExoQuick-TC kits. BM-derived DCs (BMDCs) were prepared and cocultured with MSCs-derived exosomes (100 μg/ml) for 72 hr. Mature BMDCs were derived by adding lipopolysaccharide (LPS; 0.1μg/ml) at Day 8 for 24 hr. The study groups were divided into (a) immature DC (iDC, Ctrl), (b) iDC + exosome (Exo), (c) iDC + LPS (LPS), and (d) iDC + exosome + LPS (EXO + LPS). Expression of CD11c, CD83, CD86, CD40, and MHCII on DCs was analyzed at Day 9. DC proliferation was assessed by coculture with carboxyfluorescein succinimidyl ester-labeled BALB/C-derived splenocytes p. Interleukin-6 (IL-6), IL-10, and transforming growth factor-β (TGF-β) release were measured by enzyme-linked immunosorbent assay. MSC-derived exosomes decrease DC surface marker expression in cells treated with LPS, compared with control cells ( ≤ .05). MSC-derived exosomes decrease IL-6 release but augment IL-10 and TGF-β release (p ≤ .05). Lymphocyte proliferation was decreased (p ≤ .05) in the presence of DCs treated with MSC-derived exosomes. CMSC-derived exosomes suppress the maturation of BMDCs, suggesting that they may be important modulators of DC-induced immune responses. 相似文献
46.
Nafiseh Falsafi Tahereh Soleimani Hossein Fallahi Mehri Azadbakht 《Journal of cellular physiology》2019,234(10):18813-18824
Alteration in the normal regulatory pathway of differentiation can lead to the induction of programmed cell death. Accordingly, some chemicals like staurosporine, nerve growth factor, pituitary adenylate cyclase activating peptide, and trimethyltin are shown to be able to induce differentiation in vitro, via different mechanisms in the PC12 cell line. Hence, understanding the details of the molecular mechanisms of differentiation induction by these small molecules are important for further application of these molecules in neurogenesis. Therefore, we sought to determine these signaling pathways, using gene regulatory networks analysis. Then, we have conducted a comparative analysis of the alterations in the gene expression pattern of the PC12 cell lines in response to these chemicals at the early stages. Based on the comparative analysis and previous knowledge, we have proposed the affected pathways during differentiation and apoptosis. Our findings could be useful in the development of protocols to reprogramming of neurons by such small molecules with high efficiency. 相似文献
47.
Mehri I Turki Y Chair M Chérif H Hassen A Meyer JM Gtari M 《The Journal of General and Applied Microbiology》2011,57(2):101-114
Fluorescent Pseudomonas from diverse environmental samples including wastes were identified and screened for the solubilization of tricalcium phosphate, indole-3-acetic acid (IAA), production and inhibition of extracellular N-acylhomoserine lactone (AHLs) and characterized for their siderophores. Genotypic analysis by amplified rDNA restriction analysis (ARDRA) and BOX-A1R-based repetitive extragenic palindromic-PCR (BOX-PCR) typing resulted respectively in 14 ARDRA types and 24 different BOX-types with diverse incidence among the analyzed strains. Based on 16S rRNA sequence analysis the isolates were assigned to P. aeruginosa, P. otitidis, P. plecoglossicida, P. mosselii, P. monteilii, P. koreensis, P. taiwanenesis, P. frederiksbergensis and P. graminis. Of the 66 isolates, 56 (84.85%) isolates solubilized tri-calcium phosphate (TCP), 53 (80.30%) isolates produced plant growth hormone IAA, 62 (94%) produced bacteriocin and 34 (52%) isolates produced extracellular N-acylhomoserine lactone while 30 (45%) isolates were able to interfere with N-acylhomoserine lactone. Isolates were clustered into 17 siderotypes and (59)Fe cross-incorporation experiments permitted assignment of all siderotypes but two into well-defined siderovars. 相似文献
48.
Serdar Oztuzcu Sercan Ergun Mustafa Ulaşlı Gülper Nacarkahya Yusuf Ziya Iğci Mehri Iğci Recep Bayraktar Ali Tamer Ecir Ali Çakmak Ahmet Arslan 《Molecular biology reports》2014,41(6):3671-3676
Cardiovascular disease (CVD) risk factors, such as arterial hypertension, obesity, dyslipidemia or diabetes mellitus, as well as CVDs, including myocardial infarction, coronary artery disease or stroke, are the most prevalent diseases and account for the major causes of death worldwide. In the present study, 4,709 unrelated patients subjected to CVD panel in south-east part of Turkey between the years 2010 and 2013 were enrolled and DNA was isolated from the blood samples of these patients. Mutation analyses were conducted using the real-time polymerase chain reaction method to screen six common mutations (Factor V G1691A, PT G20210A, Factor XIII V34L, MTHFR A1298C and C677T and PAI-1 ?675 4G/5G) found in CVD panel. The prevalence of these mutations were 0.57, 0.25, 2.61, 13.78, 9.34 and 24.27 % in homozygous form, respectively. Similarly, the mutation percent of them in heterozygous form were 7.43, 3.44, 24.91, 44.94, 41.09 and 45.66 %, respectively. No mutation was detected in 92 (1.95 %) patients in total. Because of the fact that this is the first study to screen six common mutations in CVD panel in south-east region of Turkey, it has a considerable value on the diagnosis and treatment of these diseases. Upon the results of the present and previous studied a careful examination for these genetic variants should be carried out in thrombophilia screening programs, particularly in Turkish population. 相似文献
49.
Masoud Baghi Elaheh Yadegari Mahsa Rostamian Delavar Maryam Peymani Mazdak Ganjalikhani-Hakemi Mehri Salari Mohammad Hossein Nasr-Esfahani Timothy L. Megraw Kamran Ghaedi 《Journal of cellular and molecular medicine》2021,25(13):6348-6360
PGC-1α/FNDC5/BDNF has found to be a critical pathway in neurodegeneration. MicroRNAs (miR(NA)s) are non-coding regulatory RNAs whose dysregulation has been observed in multiple neurological disorders, and miRNA-mediated gene deregulation plays a decisive role in PD. Here, candidate miRNA was chosen based on the literature survey and in silico studies. Chronic and acute models of PD were created using MPP+-treated SH-SY5Y cells. Twenty PD patients and 20 healthy volunteers were recruited. RT-qPCR was performed to assess the expression of miRNA and genes. Severe mitochondrial dysfunction induced by acute MPP+ treatment instigated compensatory mechanisms through enhancing expression of PGC-1α/FNDC5/BDNF pathway genes, while chronic MPP+ toxicity led to down-regulated levels of the genes in SH-SY5Y cells. PD peripheral blood mononuclear cells (PBMCs) also showed decreased expression of target genes. There were significant changes in the level of miR-193b in both models, as well as PD PBMCs. Moreover, miR-193b overexpression significantly affected PGC-1α, FNDC5 and TFAM levels. Interestingly, down-regulations of PGC-1α, FNDC5, BDNF and TFAM were inversely correlated with miR-193b up-regulation in PD PBMCs. This study showed the deregulation of PGC-1α/FNDC5/BDNF pathway in PD models and PBMCs, verifying its importance in neurodegeneration. Our findings also revealed that miR-193b functions in PD development, possibly through regulating PGC-1α/FNDC5/BDNF pathway, suggesting miR-193b as a potential biomarker for PD diagnosis. 相似文献
50.
Mehri S Abnous K Mousavi SH Shariaty VM Hosseinzadeh H 《Cellular and molecular neurobiology》2012,32(2):227-235
Acrylamide (ACR) is a potent neurotoxic in human and animal models. In this study, the effect of crocin, main constituent
of Crocus sativus L. (Saffron) on ACR-induced cytotoxicity was evaluated using PC12 cells as a suitable in vitro model. The exposure of PC12
cells to ACR reduced cell viability, increased DNA fragmented cells and phosphatidylserine exposure, and elevated Bax/Bcl-2
ratio. Results showed that ACR increased intracellular reactive oxygen species (ROS) in cells and ROS played an important
role in ACR cytotoxicity. The pretreatment of cells with 10–50 μM crocin before ACR treatment significantly attenuated ACR
cytotoxicity in a dose-dependent manner. Crocin inhibited the downregulation of Bcl-2 and the upregulation of Bax and decreased
apoptosis in treated cells. Also, crocin inhibited ROS generation in cells exposed to ACR. In conclusion, our results indicated
that pretreatment with crocin protected cells from ACR-induced apoptosis partly by inhibition of intracellular ROS production. 相似文献