Elevated intraocular pressure (IOP) is a risk factor in glaucoma, a group of irreversible blinding diseases. Endogenous lipids may be involved in regulation of IOP homeostasis. We present comparative fold analysis of phospholipids and sphingolipids of aqueous humour and trabecular meshwork from human control vs primary open-angle glaucoma and mouse control (normotensive) vs ocular hypertensive state. The fold analysis in control vs disease state was based on ratiometric mass spectrometric data for above classes of lipids. We standardized in vitro assays for rapid characterization of lipids undergoing significant diminishment in disease state. Evaluation of lipids using in vitro assays helped select a finite number of lipids that may potentially expand cellular interstitial space embedded in an artificial matrix or increase fluid flow across a layer of cells. These assays reduced a number of lipids for initial evaluation using a mouse model, DBA/2J with spontaneous IOP elevation. These lipids were then used in other mouse models for confirmation of IOP lowering potential of a few lipids that were found promising in previous assessments. Our results provide selected lipid molecules that can be pursued for further evaluation and studies that may provide insight into their function. 相似文献
Study of genetic diversity in crop plants is essential for the selection of appropriate germplasm for crop improvement. As salinity posses a serious environmental challenge to rice production globally and especially in India, it is imperative that the study of large collections of germplasms be undertaken to search for salt tolerant stocks. In the present study, 64 indica germplasms were collected from different agro-climatic zones of West Bengal, India, from the Himalayan foothills in the northern part down to the southern saline belt of the state keeping in view the soil characteristics and other edaphic factors prevailing in the region. Salt tolerance parameters were used to screen the large set of germplasms in terms of root-shoot length, fresh-dry weight, chlorophyll content, Na+/K+ ratio and germination potential in presence of salt. Standard evaluation score or SES was calculated to find out tolerant to sensitive cultivar. Twenty-one SSR markers, some associated with the Saltol QTL and others being candidate gene based SSR (cgSSR) were used to study the polymorphism of collected germplasm. A wide diversity was detected among the collected germplasms at the phenotypic as well as molecular level. Of the 21 SSR markers, 15 markers were found to be polymorphic with 88 alleles. Based on phenotypic and biochemical results, 21 genotypes were identified as salinity tolerant, whereas 40 genotypes turned out to be salt susceptible. The present study shows that apart from the established salt tolerant lines, several other landraces like Bonkanta, Morisal, Ghiosh, Patni may be the source of salt tolerant donor in future breeding programs. 相似文献
Genome wide association studies allowed prediction of 17 candidate genes for association with nitrogen use efficiency. Novel information obtained may provide better understanding of genomic controls underlying germplasm variations for this trait in Indian mustard.
Abstract
Nitrogen use efficiency (NUE) of Indian mustard (Brassica juncea (L.) Czern & Coss.) is low and most breeding efforts to combine NUE with crop performance have not succeeded. Underlying genetics also remain unexplored. We tested 92 SNP-genotyped inbred lines for yield component traits, N uptake efficiency (NUPEFF), nitrogen utilization efficiency (NUTEFF), nitrogen harvest index (NHI) and NUE for two years at two nitrogen doses (No without added N and N100 added @100 kg/ha). Genotypes IC-2489-88, M-633, MCP-632, HUJM 1080, GR-325 and DJ-65 recorded high NUE at low N. These also showed improved crop performance under high N. One determinate mustard genotype DJ-113 DT-3 revealed maximum NUTEFF. Genome wide association studies (GWAS) facilitated recognition of 17 quantitative trait loci (QTLs). Environment specificity was high. B-genome chromosomes (B02, B03, B05, B07 and B08) harbored many useful loci. We also used regional association mapping (RAM) to supplement results from GWAS. Annotation of the genomic regions around peak SNPs helped to predict several gene candidates for root architecture, N uptake, assimilation and remobilization. CAT9 (At1g05940) was consistently envisaged for both NUE and NUPEFF. Major N transporter genes, NRT1.8 and NRT3.1 were predicted for explaining variation for NUTEFF and NUPEFF, respectively. Most significant amino acid transporter gene, AAP1 appeared associated with NUE under limited N conditions. All these candidates were predicted in the regions of high linkage disequilibrium. Sequence information of the predicted candidate genes will permit development of molecular markers to aid breeding for high NUE.
Molecular Biology Reports - Globally, breast cancer is a serious concern that exhibits a persistent rise in its incidence and related mortality even after significant advancement in the field of... 相似文献
Journal of Plant Biochemistry and Biotechnology - Pigeonpea sterility mosaic emaraviruses (PPSMVs) cause sterility mosaic disease in pigeonpea which significantly reduce the crop yield. Currently... 相似文献
Phosphorus (P) is an essential macronutrient to all crops including rice and it plays a key role in various plant activities and development. Low availability of P in the soils negatively, influences rice crop growth and causes significant yield loss. In the present study, we characterized a set of 56 germplasm lines for their tolerance to low soil P by screening them at low soil P and optimum soil P levels along with low soil P tolerant and sensitive check varieties. These lines were genotyped for the presence/absence of tolerant allele with respect to the major low soil P tolerance QTL, Pup1, using a set of locus specific PCR-based markers, viz., K46-1, K46-2, K52 and K46CG-1. High genetic variability was observed for various traits associated with low soil P tolerance. The yield parameters from normal and low soil P conditions were used to calculate stress tolerance indices and classify the genotypes according to their tolerance level. Out of the total germplasm lines screened, 15 lines were found to be tolerant to low soil P condition based on the yield reduction in comparison to the tolerant check, but most of them harbored the complete or partial Pup1 locus. Interestingly, two tolerant germplasm lines, IC216831 and IC216903 were observed to be completely devoid of Pup1 and hence they can be explored for new loci underlying low soil P tolerance.
Abstract A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione (6) has been accomplished. The structural conformation of (6) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside (6) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0. 相似文献
Smokeless tobacco usage is a growing public health problem worldwide. The molecular mechanism(s) underlying smokeless tobacco associated tissue damage remain largely unidentified. In the present study we have tried to explore the effects of aqueous extract of smokeless tobacco (STE) on tubulin-microtubule, the major cytoskeleton protein that maintains cells morphology and participates in cell division. Exposure to STE resulted in dose-dependent cytotoxicity in a variety of mammalian transformed cell lines such as human lung epithelial cells A549, human liver epithelial cells HepG2, and mouse squamous epithelial cells HCC7, as well as non-tumorogenic human peripheral blood mononuclear cells PBMC. Cellular morphology of STE-treated cells was altered and the associated disruption of microtubule network indicates that STE targets tubulin-microtubule system in both cell lines. Furthermore it was also observed that STE-treatment resulted in the selective degradation of cellular tubulin, whereas actin remains unaltered. In vitro, polymerization of purified tubulin was inhibited by STE with the IC50 value∼150 µg/ml and this is associated with the loss of reactive cysteine residues of tubulin. Application of thiol-based antioxidant N-acetyl cysteine (NAC) significantly abrogates STE-mediated microtubule damage and associated cytotoxicity in both A549 and HepG2 cells. These results suggest that microtubule damage is one of the key mechanisms of STE-induced cytotoxity in mammalian cells. 相似文献