FGF signaling through FGFR1 is required for olfactory bulb morphogenesis

During development, the embryonic telencephalon is patterned into different areas that give rise to distinct adult brain structures. Several secreted signaling molecules are expressed at putative signaling centers in the early telencephalon. In particular, Fgf8 is expressed at the anterior end of the telencephalon and is hypothesized to pattern it along the anteroposterior (AP) axis. Using a CRE/loxP genetic approach to disrupt genes in the telencephalon, we address the role of FGF signaling directly in vivo by abolishing expression of the FGF receptor Fgfr1. In the Fgfr1-deficient telencephalon, AP patterning is largely normal. However, morphological defects are observed at the anterior end of the telencephalon. Most notably, the olfactory bulbs do not form normally. Examination of the proliferation state of anterior telencephalic cells supports a model for olfactory bulb formation in which an FGF-dependent decrease in proliferation is required for initial bulb evagination. Together the results demonstrate an essential role for Fgfr1 in patterning and morphogenesis of the telencephalon.     

Progressive restriction in fate potential by neural progenitors during cerebral cortical development

During early stages of cerebral cortical development, progenitor cells in the ventricular zone are multipotent, producing neurons of many layers over successive cell divisions. The laminar fate of their progeny depends on environmental cues to which the cells respond prior to mitosis. By the end of neurogenesis, however, progenitors are lineally committed to producing upper-layer neurons. Here we assess the laminar fate potential of progenitors at a middle stage of cortical development. The progenitors of layer 4 neurons were first transplanted into older brains in which layer 2/3 was being generated. The transplanted neurons adopted a laminar fate appropriate for the new environment (layer 2/3), revealing that layer 4 progenitors are multipotent. Mid-stage progenitors were then transplanted into a younger environment, in which layer 6 neurons were being generated. The transplanted neurons bypassed layer 6, revealing that layer 4 progenitors have a restricted fate potential and are incompetent to respond to environmental cues that trigger layer 6 production. Instead, the transplanted cells migrated to layer 4, the position typical of their origin, and also to layer 5, a position appropriate for neither the host nor the donor environment. Because layer 5 neurogenesis is complete by the stage that progenitors were removed for transplantation, restrictions in laminar fate potential must lag behind the final production of a cortical layer. These results suggest that a combination of intrinsic and environmental cues controls the competence of cortical progenitor cells to produce neurons of different layers.     

pH stability of HLA-DR4 complexes with antigenic peptides

Complexes between antigenic peptides and class II proteins of the major histocompatibility complex (MHC) trigger cellular immune responses. These complexes usually dissociate more rapidly at mildly acidic pH, where they are formed intracellularly, as compared to neutral pH, where they function at the cell surface. This paper describes the pH dependence of the dissociation kinetics of complexes between MHC proteins and antigenic peptides containing aspartic and glutamic acid residues. Some of these complexes show an unusual pH dependence, dissociating much more rapidly at pH 7 than at pH 5.3. This occurs when the carboxylate group of the aspartic or glutamic acid residue is located in a neutral pocket of the protein. In contrast, solvent-exposed carboxylate groups or carboxylate groups buried in pockets where they form salt bridges with the protein do not show this unusual pH dependence. The kinetic data having the unusual pH dependence conform closely to a model in which there is a rapid reversible equilibration between a less stable deprotonated complex and a more stable protonated complex. In this model, the pK(a) of the protonation reaction for the partially buried peptide carboxylate group ranges from 7.7 to 8.3, reflecting the strongly basic conditions required for deprotonation. One of the few peptide/MHC complexes demonstrated to play a role in autoimmunity in humans contains a buried peptide carboxylate and shows this unusual pH dependence. The relevance of this finding to understanding the chemical basis of autoimmunity is briefly discussed.     

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.     

The prehistoric use of Chenopodiaceae in Australia: Evidence from Carpenter's Gap shelter 1 in the Kimberley, Australia

The use of Chenopodiaceae and Amaranthaceae has been recorded in a rock shelter site that shows evidence of human occupation from 40,000 B.P. more or less continuously to the present. The plant remains are discussed in the light of ethnographic information for use of these taxa in both Australia and north America. The presence of cheno-ams as environmental indicators of aridity will be discussed.     

In-Depth Characterization of Sheep (Ovis aries) Milk Whey Proteome and Comparison with Cow (Bos taurus)

An in-depth proteomic study of sheep milk whey is reported and compared to the data available in the literature for the cow whey proteome. A combinatorial peptide ligand library kit (ProteoMiner) was used to normalize protein abundance in the sheep whey proteome followed by an in-gel digest of a 1D-PAGE display and an in-solution digestion followed by OFFGEL isoelectric focusing fractionation. The peptide fractions obtained were then analyzed by LC-MS/MS. This enabled identification of 669 proteins in sheep whey that, to our knowledge, is the largest inventory of sheep whey proteins identified to date. A comprehensive list of cow whey proteins currently available in the literature (783 proteins from unique genes) was assembled and compared to the sheep whey proteome data obtained in this study (606 proteins from unique genes). This comparison revealed that while the 233 proteins shared by the two species were significantly enriched for immune and inflammatory responses in gene ontology analysis, proteins only found in sheep whey in this study were identified that take part in both cellular development and immune responses, whereas proteins only found in cow whey in this study were identified to be associated with metabolism and cellular growth.     

Personalized Oncogenomics: Clinical Experience with Malignant Peritoneal Mesothelioma Using Whole Genome Sequencing

Peritoneal mesothelioma is a rare and sometimes lethal malignancy that presents a clinical challenge for both diagnosis and management. Recent studies have led to a better understanding of the molecular biology of peritoneal mesothelioma. Translation of the emerging data into better treatments and outcome is needed. From two patients with peritoneal mesothelioma, we derived whole genome sequences, RNA expression profiles, and targeted deep sequencing data. Molecular data were made available for translation into a clinical treatment plan. Treatment responses and outcomes were later examined in the context of molecular findings. Molecular studies presented here provide the first reported whole genome sequences of peritoneal mesothelioma. Mutations in known mesothelioma-related genes NF2, CDKN2A, LATS2, amongst others, were identified. Activation of MET-related signaling pathways was demonstrated in both cases. A hypermutated phenotype was observed in one case (434 vs. 18 single nucleotide variants) and was associated with a favourable outcome despite sarcomatoid histology and multifocal disease. This study represents the first report of whole genome analyses of peritoneal mesothelioma, a key step in the understanding and treatment of this disease.     

Excitation dynamics in Photosystem I from Chlamydomonas reinhardtii. Comparative studies of isolated complexes and whole cells

Identical time-resolved fluorescence measurements with ~ 3.5-ps resolution were performed for three types of PSI preparations from the green alga, Chlamydomonas reinhardtii: isolated PSI cores, isolated PSI–LHCI complexes and PSI–LHCI complexes in whole living cells. Fluorescence decay in these types of PSI preparations has been previously investigated but never under the same experimental conditions. As a result we present consistent picture of excitation dynamics in algal PSI. Temporal evolution of fluorescence spectra can be generally described by three decay components with similar lifetimes in all samples (6–8 ps, 25–30 ps, 166–314 ps). In the PSI cores, the fluorescence decay is dominated by the two fastest components (~ 90%), which can be assigned to excitation energy trapping in the reaction center by reversible primary charge separation. Excitation dynamics in the PSI–LHCI preparations is more complex because of the energy transfer between the LHCI antenna system and the core. The average trapping time of excitations created in the well coupled LHCI antenna system is about 12–15 ps longer than excitations formed in the PSI core antenna. Excitation dynamics in PSI–LHCI complexes in whole living cells is very similar to that observed in isolated complexes. Our data support the view that chlorophylls responsible for the long-wavelength emission are located mostly in LHCI. We also compared in detail our results with the literature data obtained for plant PSI.     

Prevalence of hyperthyroidism after exposure during childhood or adolescence to radioiodines from the chornobyl nuclear accident: dose-response results from the Ukrainian-American Cohort Study

Relatively few data are available on the prevalence of hyperthyroidism (TSH concentrations of <0.3 mIU/liter, with normal or elevated concentrations of free T4) in individuals exposed to radioiodines at low levels. The accident at the Chornobyl (Chernobyl) nuclear plant in Ukraine on April 26, 1986 exposed large numbers of residents to radioactive fallout, principally to iodine-131 ((131)I) (mean and median doses = 0.6 Gy and 0.2 Gy). We investigated the relationship between (131)I and prevalent hyperthyroidism among 11,853 individuals exposed as children or adolescents in Ukraine who underwent an in-depth, standardized thyroid gland screening examination 12-14 years later. Radioactivity measurements taken shortly after the accident were available for all subjects and were used to estimate individual thyroid doses. We identified 76 cases of hyperthyroidism (11 overt, 65 subclinical). Using logistic regression, we tested a variety of continuous risk models and conducted categorical analyses for all subjects combined and for females (53 cases, n = 5,767) and males (23 cases, n = 6,086) separately but found no convincing evidence of a dose-response relationship between (131)I and hyperthyroidism. There was some suggestion of elevated risk among females in an analysis based on a dichotomous dose model with a threshold of 0.5 Gy chosen empirically (OR = 1.86, P = 0.06), but the statistical significance level was reduced (P = 0.13) in a formal analysis with an estimated threshold. In summary, after a thorough exploration of the data, we found no statistically significant dose-response relationship between individual (131)I thyroid doses and prevalent hyperthyroidism.