The metallo-beta-lactamase GOB is a mono-Zn(II) enzyme with a novel active site

Metallo-beta-lactamases (MbetaLs) are zinc-dependent enzymes able to hydrolyze and inactivate most beta-lactam antibiotics. The large diversity of active site structures and metal content among MbetaLs from different sources has limited the design of a pan-MbetaL inhibitor. Here we report the biochemical and biophysical characterization of a novel MbetaL, GOB-18, from a clinical isolate of a Gram-negative opportunistic pathogen, Elizabethkingia meningoseptica. Different spectroscopic techniques, three-dimensional modeling, and mutagenesis experiments, reveal that the Zn(II) ion is bound to Asp120, His121, His263, and a solvent molecule, i.e. in the canonical Zn2 site of dinuclear MbetaLs. Contrasting all other related MbetaLs, GOB-18 is fully active against a broad range of beta-lactam substrates using a single Zn(II) ion in this site. These data further enlarge the structural diversity of MbetaLs.     

Visceral leishmaniasis: what are the needs for diagnosis, treatment and control?

Visceral leishmaniasis (VL) is a systemic protozoan disease that is transmitted by phlebotomine sandflies. Poor and neglected populations in East Africa and the Indian sub-continent are particularly affected. Early and accurate diagnosis and treatment remain key components of VL control. In addition to improved diagnostic tests, accurate and simple tests are needed to identify treatment failures. Miltefosine, paromomycin and liposomal amphotericin B are gradually replacing pentavalent antimonials and conventional amphotericin B as the preferred treatments in some regions, but in other areas these drugs are still being evaluated in both mono- and combination therapies. New diagnostic tools and new treatment strategies will only have an impact if they are made widely available to patients.     

Insulin adsorption onto zinc oxide nanoparticle mediates conformational rearrangement into amyloid-prone structure with enhanced cytotoxic propensity

Background

Injection localized amyloidosis is one of the most prevalent disorders in type II diabetes mellitus (TIIDM) patients relying on insulin injections. Previous studies have reported that nanoparticles can play a role in the amyloidogenic process of proteins. Hence, the present study deals with the effect of zinc oxide nanoparticles (ZnONP) on the amyloidogenicity and cytotoxicity of insulin.

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Tick tock,tick tock: Mouse culture and tissue aging captured by an epigenetic clock

Aging is associated with dramatic changes to DNA methylation (DNAm), although the causes and consequences of such alterations are unknown. Our ability to experimentally uncover mechanisms of epigenetic aging will be greatly enhanced by our ability to study and manipulate these changes using in vitro models. However, it remains unclear whether the changes elicited by cells in culture can serve as a model of what is observed in aging tissues in vivo. To test this, we serially passaged mouse embryonic fibroblasts (MEFs) and assessed changes in DNAm at each time point via reduced representation bisulfite sequencing. By developing a measure that tracked cellular aging in vitro, we tested whether it tracked physiological aging in various mouse tissues and whether anti‐aging interventions modulate this measure. Our measure, termed CultureAGE, was shown to strongly increase with age when examined in multiple tissues (liver, lung, kidney, blood, and adipose). As a control, we confirmed that the measure was not a marker of cellular senescence, suggesting that it reflects a distinct yet progressive cellular aging phenomena that can be induced in vitro. Furthermore, we demonstrated slower epigenetic aging in animals undergoing caloric restriction and a resetting of our measure in lung and kidney fibroblasts when re‐programmed to iPSCs. Enrichment and clustering analysis implicated EED and Polycomb group (PcG) factors as potentially important chromatin regulators in translational culture aging phenotypes. Overall, this study supports the concept that physiologically relevant aging changes can be induced in vitro and used to uncover mechanistic insights into epigenetic aging.     

Genetic improvement of peanut (Arachis hypogea L.) genotypes by developing short duration hybrids

Peanut, the only cash crop of rainfed areas of Pakistan, is facing immense challenges due to global warming. Climatic factors particularly the temperature fluctuations and rain pattern shift significantly impact the production and yield of peanut and unavailability of resilient varieties exacerbate this impact. To deal with the cropping pattern change and yield losses, due to climate vagaries, a study was conducted to develop early maturing hybrids using line into tester mating design. The F₁ hybrids from the parental lines were produced in the year 2018 using Line × Tester mating design and then grown in the field in the year 2019 for further evaluation. The hybrids were evaluated based on the early maturity and yield-related attributes in comparison with the parental lines. Based on the general combining ability estimate, line V-3 (Golden), was found as best parent with highly significant values for plant height, days to peg formation, days to maturity, number of pegs per plant, number of pods per plants, number of seeds per plant, 100 pod weight 100 seed weight. Similarly, tester V-7 (PI 635006 01 SD) showed highly significant results of GCA for days to germination, day to 50% flowering, plant height, days to peg formation, days to maturity, number of pegs per plant, number of pods per plants, number of seeds per plant, 100 kernel weight, shelling percentage. All the combinations were evaluated for specific combining ability and significant results were observed for V-3 × V-4 (Golden × PI 619175 01 SD) and V-1 × V-6 (BARI-2000 × PI 564846 01 SD) by developing or maturity and yield-related attributes. The hybrid combinations V-3 × V-5 (Golden × PI 635006 01 SD) followed by V-3 × V-6 showed highly significant results for mid parent heterosis and better parent heterosis for days to 50% flowering, plant height, days to peg formation, number of pegs, days to maturity, number of mature seeds per plant, shelling ratio, 100 pod weight and 100 kernel weight. These parents and hybrid combinations with early maturity genes and high yield attributes can further be used for the development of short duration variety.