Comparative cytogenetic studies in Sus verrucosus,Sus celebensis and Sus scrofa vittatus (Suidae,Mammalia)

Chromosome studies on the Javan warty pig (Sus verrucosus), the Sulawesi warty pig (S. celebensis) and a subspecies of the wild boar, S. scrofa vittatus, have revealed diploid chromosome numbers of 38. The morphology and C-band size of chromosome 10 are different in S. verrucosus and the two other species. Both S. verrucosus and S. celebensis have a Y chromosome that is larger than the Y chromosome of domestic and wild S. scrofa, and is submetacentric rather than metacentric. There are differences between all three species in the G-banding pattern of the long arm of the Y chromosome. The presence of 2n=38 chromosomes in the Javan warty pig and the Sulawesi warty pig provides new strong evidence that the basic chromosome number in the genus Sus is 38. The differences in karyotype between these pigs (chromosome 10 and the Y chromosome) confirm that they are separate species.     

The influence of mean climate trends and climate variance on beaver survival and recruitment dynamics

Ecologists are increasingly aware of the importance of environmental variability in natural systems. Climate change is affecting both the mean and the variability in weather and, in particular, the effect of changes in variability is poorly understood. Organisms are subject to selection imposed by both the mean and the range of environmental variation experienced by their ancestors. Changes in the variability in a critical environmental factor may therefore have consequences for vital rates and population dynamics. Here, we examine ≥90‐year trends in different components of climate (precipitation mean and coefficient of variation (CV); temperature mean, seasonal amplitude and residual variance) and consider the effects of these components on survival and recruitment in a population of Eurasian beavers (n = 242) over 13 recent years. Within climatic data, no trends in precipitation were detected, but trends in all components of temperature were observed, with mean and residual variance increasing and seasonal amplitude decreasing over time. A higher survival rate was linked (in order of influence based on Akaike weights) to lower precipitation CV (kits, juveniles and dominant adults), lower residual variance of temperature (dominant adults) and lower mean precipitation (kits and juveniles). No significant effects were found on the survival of nondominant adults, although the sample size for this category was low. Greater recruitment was linked (in order of influence) to higher seasonal amplitude of temperature, lower mean precipitation, lower residual variance in temperature and higher precipitation CV. Both climate means and variance, thus proved significant to population dynamics; although, overall, components describing variance were more influential than those describing mean values. That environmental variation proves significant to a generalist, wide‐ranging species, at the slow end of the slow‐fast continuum of life histories, has broad implications for population regulation and the evolution of life histories.     

Cephaloglycin and Its Biologically Active Metabolite Desacetylcephaloglycin

Chromatographic studies and microbiological assays show that, after oral administration, cephaloglycin is partially converted in man to a biologically active metabolite desacetylcephaloglycin. The antibacterial activity of this metabolite compared to that of cephaloglycin is equivalent against gram-positive organisms but is lower against gram-negative bacilli. Successful therapy of urinary tract infections with cephaloglycin must be mainly attributed to the antibacterial activity of this metabolite. At the present time, it is not possible to assess what influence low amounts of unaltered cephaloglycin have on the outcome of therapy.     

Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of α-Amy2 genes

The promoters of wheat, barley and wild oat -Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56–58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X_4–5-C-X_22–23-H-X₁-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.     

Sex steroid and glucocorticoid receptors in the bursa of Fabricius of obese strain chickens spontaneously developing autoimmune thyroiditis

The female sex develops autoimmune disease far more often than the male. This is claimed to be due to differences in peripheral sex steroid levels. We have examined in the bursa of Fabricius of Obese strain (OS) chickens, which spontaneously develop autoimmune thyroiditis, as well as in their healthy counterparts androgen(AR)-, estrogen(ER)-, progestin(PR)- and glucocorticoid(GR)-receptors in an attempt to elucidate possible further pathomechanisms, namely at the target site of steroid hormones. The characterization (affinity, specificity, association- and dissociation-rate, sedimentation behaviour) of all four types of receptors revealed no difference between sex or strain. Furthermore, the ontogeny study of the receptor capacity and affinity from the 7th embryonic day (i.e. before lymphocyte settlement) until bursa involution, again showed no difference between OS and healthy chickens of either sex. Thus, it can be concluded that the principal sex dependency of the susceptibility to autoimmune disease results predominantly from differences in sex steroid levels per se, although alterations in mechanisms beyond the cytosolic receptor level can presently not be excluded.     

Incidence of leukaemia and other malignant diseases following injections of the short-lived α-emitter <Superscript>224</Superscript>Ra into man

We performed an epidemiological study on 1,471 ankylosing spondylitis patients treated with repeated intravenous injections of the short lived α-emitter ²²⁴Ra (excluding radiation therapy with X-rays) between 1948 and 1975. These patients have been followed together with a control group of 1,324 ankylosing spondylitis patients treated neither with radioactive drugs nor with X-rays. The mean follow-up time was 26.3 years in the exposed and 24.6 years in the control group. To date, causes of death have been ascertained for 1,006 exposed patients and 1,072 controls. Special emphasis was placed on the reporting of malignant diseases. Expected numbers of cases were computed for the age, sex and calendar year distribution of both groups using cancer registry incidence rates. In the exposed group 18 cases of kidney cancer (vs. 9.1 cases expected, P < 0.01) and 4 malignant thyroid tumours (vs. 1.2 cases expected, P = 0.03) were observed. In the control group the observed cases for these tumours were not significantly elevated. The most striking observation, however, were the 21 cases of leukaemia in the exposed group (vs. 6.8 cases expected, P < 0.001) compared to 12 cases of leukaemia in the control group (vs. 7.5 cases expected). Further sub-classification of the leukaemias demonstrated a high increase of myeloid leukaemia in the exposed group (12 cases observed vs. 2.9 cases expected, P < 0.001), and out of these, especially a high excess of acute myeloid leukaemias (7 cases observed vs. 1.8 expected, P = 0.003). In the controls the observed cases are within the expected range (4 myeloid leukaemias vs. 3.1 cases). This increase in total leukaemias as well as particularly in myeloid leukaemias is significant in direct comparison between the exposed and control groups too (P < 0.05). The enhanced leukaemia incidence in the exposed group is in line with the observation of increased leukaemia incidence in mice injected with ²²⁴Ra.     

Response of the phosphatidylcholine headgroup to membrane surface charge in ternary mixtures of neutral, cationic, and anionic lipids: a deuterium NMR study.

Deuterium nuclear magnetic resonance (2H NMR) spectroscopy was used to investigate the response of the phosphatidylcholine headgroup of 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC) to changes in surface electrostatic charge in membranes consisting of ternary mixtures of lipids. DMPC was deuterated at the choline alpha- and beta-methylene segments. The membrane surface charge was manipulated by the simultaneous addition of cationic didodecyldimethylammonium bromide (DDAB) and anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) to neutral DMPC. Addition of increasing amounts of DDAB caused a progressive decrease (increase) in the 2H NMR quadrupole splitting from DMPC-alpha-d2 (DMPC-beta-d2). Addition of increasing amounts of DMPG caused a progressive increase (decrease) in the quadrupole splitting from DMPC-alpha-d2 (DMPC-beta-d2). Qualitatively, the 2H NMR quadrupole splitting charge response exhibited the same main features for ternary mixtures of DDAB/DMPG/DMPC and binary mixtures of DDAB/DMPC or DMPG/DMPC. Quantitatively, however, the 2H NMR quadrupole splittings obtained from ternary mixtures did not coincide with those obtained from binary mixtures of nominally identical surface charge densities. Hence, the quadrupole splitting did not respond directly to the net membrane surface charge. Instead, the quadrupole splitting measured for a given ternary lipid composition could be reproduced by summing the individual effects of the charged lipids in binary mixtures, weighted according to their appropriate mole fractions.