High vapor pressure deficit drives salt‐stress‐induced rice yield losses in India

Flooded rice is grown across wide geographic boundaries from as far north as Manchuria and as far south as Uruguay and New South Wales, primarily because of its adaptability across diverse agronomic and climatic conditions. Salt‐stress damage, a common occurrence in delta and coastal rice production zones, could be heightened by the interactions between high temperature and relative humidity (vapor pressure deficit – VPD). Using temporal and spatial observations spanning 107 seasons and 19 rice‐growing locations throughout India with varying electrical conductivity (EC), including coastal saline, inland saline, and alkaline soils, we quantified the proportion of VPD inducing salinity damage in rice. While controlling for time‐invariant factors such as trial locations, rice cultivars, and soil types, our regression analysis indicates that EC has a nonlinear detrimental effect on paddy rice yield. Our estimates suggest these yield reductions become larger at higher VPD. A one standard deviation (SD) increase in EC from its mean value is associated with 1.68% and 4.13% yield reductions at median and maximum observed VPD levels, respectively. Yield reductions increase roughly sixfold when the one SD increase is taken from the 75th percentile of EC. In combination, high EC and VPD generate near catastrophic crop loss as predicted yield approaches zero. If higher VPD levels driven by global warming materialize in conjunction with rising sea levels or salinity incursion in groundwater, this interaction becomes an important and necessary predictor of expected yield losses and global food security.     

Comparison of the Pseudorabies Virus Us9 Protein with Homologs from Other Veterinary and Human Alphaherpesviruses

Pseudorabies virus (PRV) Us9 is a small, tail-anchored (TA) membrane protein that is essential for axonal sorting of viral structural proteins and is highly conserved among other members of the alphaherpesvirus subfamily. We cloned the Us9 homologs from two human pathogens, varicella-zoster virus (VZV) and herpes simplex virus type 1 (HSV-1), as well as two veterinary pathogens, equine herpesvirus type 1 (EHV-1) and bovine herpesvirus type 1 (BHV-1), and fused them to enhanced green fluorescent protein to examine their subcellular localization and membrane topology. Akin to PRV Us9, all of the Us9 homologs localized to the trans-Golgi network and had a type II membrane topology (typical of TA proteins). Furthermore, we examined whether any of the Us9 homologs could compensate for the loss of PRV Us9 in anterograde, neuron-to-cell spread of infection in a compartmented chamber system. EHV-1 and BHV-1 Us9 were able to fully compensate for the loss of PRV Us9, whereas VZV and HSV-1 Us9 proteins were unable to functionally replace PRV Us9 when they were expressed in a PRV background.Alphaherpesviruses are classified by their variable host range, short reproductive cycle, and ability to establish latency in the peripheral nervous system (PNS) (36, 37). Commonly studied pathogens of this subfamily include herpes simplex virus (HSV) and varicella-zoster virus (VZV), as well as the veterinary pathogens pseudorabies virus (PRV), equine herpesvirus (EHV), and bovine herpesvirus (BHV). Initial infection begins with the virus entering the host mucosal surfaces and spreading between cells of the mucosal epithelium. Invariably, virus enters the PNS through the infection of peripheral nerves that innervate this region. The virus establishes a latent infection in PNS neurons that can be reactivated and that persists for the life of the host (36). In most natural infections, virus replication in the PNS never spreads to the central nervous system (CNS). However, on rare occasions, invasion of the CNS does occur, resulting in devastating encephalitis (46). Trafficking of virus particles from infected epithelial cells into the axon and subsequent transport to neuronal cell bodies is known as retrograde spread of infection. Trafficking of virus particles that are assembled in the neuronal cell body and subsequently sorted into axons for transport to epithelial cells at the initial site of infection (upon reactivation from latency) is known as anterograde spread of infection.Though the natural host of PRV is swine, the virus infects a wide variety of animals, including rodents, cats, dogs, rabbits, cattle, and chicken embryos, but not higher primates (1, 30, 47). In contrast to the well-contained spread of PRV within its natural host, infection of other mammals is usually lethal. Instead of stopping in the PNS, infection continues on to second-order and third-order neurons in the CNS (reviewed in reference 35). This facet of PRV infection makes it a useful tracer of neuronal connections (18). Work in our lab has identified three PRV proteins, Us9 and the gE/gI heterodimer, which are critical for efficient anterograde spread of infection in vivo (i.e., spread from presynaptic to postsynaptic neurons) (6, 45). The molecular mechanism by which these proteins function has been further elucidated in vitro using primary neuronal cultures of superior cervical ganglion (SCG) harvested from embryonic rat pups. PRV Us9 and, to a lesser extent, gE/gI are required for efficient axonal targeting of viral structural proteins, a necessary step for subsequent anterograde, transneuronal spread (10, 11, 27, 28, 42).PRV Us9 is a type II, tail-anchored (TA) membrane protein that is highly enriched in lipid raft microdomains and resides predominantly in or near the trans-Golgi network (TGN) inside infected cells (5-7, 27). It has homologs in most of the alphaherpesviruses, including VZV (16), HSV-1 (22), HSV-2 (17), EHV-1 (21, 40), EHV-4 (41), BHV-1 (25), and BHV-5 (14). Though several studies have examined individually the Us9 proteins encoded by VZV (16), HSV-1 (4, 22, 34, 39), BHV-1 (13), and BHV-5 (14), several gaps in our understanding of Us9 biology remain, namely, whether all of the PRV Us9 homologs are type II membrane proteins, if the proteins localize to similar subcellular compartments within different cell types, and if they can functionally substitute for the loss of PRV Us9 in axonal sorting and anterograde spread of infection. The aim of this study is to examine PRV Us9 in parallel assays with its homologs from VZV, HSV-1, EHV-1, and BHV-1 to identify potential similarities and differences between these highly conserved alphaherpesvirus proteins.     

Continuous-time modeling of cell fate determination in Arabidopsis flowers

Background  

The genetic control of floral organ specification is currently being investigated by various approaches, both experimentally and through modeling. Models and simulations have mostly involved boolean or related methods, and so far a quantitative, continuous-time approach has not been explored.     

Genetic Mapping of the Cloned Subgroup A Avian Sarcoma and Leukosis Virus Receptor Gene to the TVA Locus

A chicken gene conferring susceptibility to subgroup A avian sarcoma and leukosis viruses (ASLV-A) was recently identified by a gene transfer strategy. Classical genetic approaches had previously identified a locus, TVA, that controls susceptibility to ASLV-A. Using restriction fragment length polymorphism (RFLP) mapping in inbred susceptible (TVA*S) and resistant (TVA*R) chicken lines, we demonstrate that in 93 F₂ progeny an RFLP for the cloned receptor gene segregates with TVA. From these analyses we calculate that the cloned receptor gene lies within 5 centimorgans of TVA, making it highly probable that the cloned gene is the previously identified locus TVA. The polymorphism that distinguishes the two alleles of TVA in these inbred lines affects the encoded amino acid sequence of the region of Tva that encompasses the viral binding domain. However, analysis of the genomic sequence encoding this region of Tva in randomly bred chickens suggests that the altered virus binding domain is not the basis for genetic resistance in the chicken lines analyzed.Avian sarcoma and leukosis viruses (ASLV) may be classified into several subgroups based on properties of the viral envelope proteins. Five major subgroups of ASLV (A to E) have been defined based on immunological reactivity of the viral envelope proteins, host range, and infection interference patterns (reviewed in reference 18). The subgroup specificity of the virus maps to the env gene, and distinct hypervariable regions within env have been shown to determine the viral subgroup (2, 3, 7, 8).Patterns of susceptibility of inbred chicken lines to infection with the various ASLV subgroups suggest that three loci control viral entry for the five major ASLV subgroups (11, 12, 15, 17). Dominant alleles at the TVA and TVC (TVA*S and TVC*S) loci confer susceptibility to subgroups A and C viruses, respectively. The TVB locus is more complex, with various alleles determining infection by subgroup B, D, and E viruses. TVA, TVB, and TVC appear to act at the level of viral entry into the cell; therefore, it has been assumed that the TV loci encode or control expression of the cellular receptors for ASLV (5, 13).Recently, a gene that confers susceptibility to subgroup A ASLV (ASLV-A) was cloned by a gene transfer strategy (1, 19). Molecular clones containing coding sequences for this gene relieve the block to viral entry when expressed in a number of mammalian cell lines (1, 19). The gene encodes a surface glycoprotein that has been shown to bind directly and specifically to the ASLV-A envelope protein (4, 9). In addition, binding of the receptor protein to ASLV-A envelope protein induces conformational changes in the viral glycoproteins that appear to be associated with viral entry (10). Finally, an antibody to the receptor protein specifically blocks infection of chicken cells by subgroup A viruses, suggesting that this gene encodes the normal ASLV-A receptor on chicken cells (1). Taken together, these results demonstrate that the cloned gene encodes a subgroup A virus receptor.Since it is clear that the cloned gene encodes an ASLV-A receptor, the protein supposed to be encoded by the classical TVA locus, we asked whether the identified receptor gene mapped to the TVA locus. In this paper we show that a restriction fragment length polymorphism (RFLP) of DNA from inbred chickens can be used to demonstrate that the cloned ASLV-A receptor gene maps to within 5 centimorgans (cM) of the TVA locus as defined by susceptibility to ASLV-A, making it highly probable that the cloned gene is TVA. In addition, analysis of the genomic sequences encoding the viral interaction domain of the receptor in both inbred and randomly bred chickens demonstrates that alterations in this region of the receptor are not responsible for the resistance phenotype.

TVA segregation analysis.

Inbred chicken lines homozygous for TVA alleles encoding either sensitivity (TVA*S) or resistance (TVA*R) were used to generate birds in which the TVA segregation pattern could be studied. Regional Poultry Research Lab lines 6₃ (TVA*S/*S TVB*S/*S) and 7₂ (TVA*R/*R TVB*R/*R) (6) were crossed, and the resulting heterozygous F₁ progeny were mated to generate 93 F₂ chicks. The susceptibility phenotype of the F₂ chicks was determined on the basis of tumor formation following subcutaneous injection of 500 focus-forming units (FFU) of subgroup A Bryan high-titer Rous sarcoma virus (RSV) (RAV-1) and 500 FFU of subgroup B Bryan high-titer RSV (RAV-2) into the right and left wing webs, respectively, of 4-week-old chicks. At 2, 3, and 4 weeks postinjection the wings were palpated to check for tumor development. Chicks were scored as positive for susceptibility (e.g., TVA*S/*S or TVA*S/*R) if a tumor of any size formed in the appropriate wing web.Table ​Table11 summarizes the distribution of susceptibility to subgroups A and B RSV in the F₂ chicks. Segregation of TVB yielded roughly the predicted frequency of susceptible (67 observed versus 70 expected) and resistant (26 observed versus 23 expected) progeny for a dominant locus (P > 0.05). In contrast, the distribution of subgroup A-susceptible and -resistant birds deviated significantly from the expected 3:1 ratio, with an excessive number of subgroup A-resistant chicks observed and a ratio of 2:1 (χ² = 3.4) (Table ​(Table1).1). Previous analysis of the segregation of TVA using the same chicken lines did not reveal an altered distribution of sensitive and resistant birds (6), suggesting that the bias seen here may be a chance deviation from the expected ratio. Segregation of two endogenous virus loci, ALVE2 (previously designated ev2) (carried by line 7₂) and ALVE3 (previously designated ev3) (carried by line 6₃), also gave roughly the expected 3:1 ratio in these F₂ chicks (data not shown). When the segregation bias in the ASLV-A-susceptible birds was accounted for, then susceptibility to subgroup A and B RSV segregated independently, as was expected since the TVA and TVB genes have been reported to be unlinked (6). Recent mapping studies also confirmed that TVA and TVB are found on different linkage groups (3a).

TABLE 1

Segregation of resistance and susceptibility to subgroup A and B viruses in F₂ progeny obtained by crossing lines 6₃ and 7₂

Purification and Initial Characterization of Rat B49 Glial Cell Line-Derived Neurotrophic Factor

Abstract: The rat glial cell line B49 releases into its culture medium a potent neurotrophic factor that exhibits relative specificity for the dopaminergic neurons in dissociated cultures of rat embryonic midbrain. This factor is a heparin-binding, basic protein that is heterogeneously glycosylated and migrates on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and on molecular sieve chromatography with an apparent mass of ∼33–45 kDa. The factor behaves like a disulfide-bonded homodimer, whose biological activity is destroyed by reduction of disulfide bonds but not by SDS-PAGE or reversed-phase (RP)-HPLC. The apparent mass of the monomer is ∼16 kDa after deglycosylation with N-Glycanase. This factor has been purified 34,000-fold to apparent homogeneity by a combination of heparin-affinity chromatography, molecular sieving chromatography, SDS-PAGE, and RP-HPLC. The purified rat protein promotes the survival, morphological differentiation, and high-affinity dopamine reuptake of dopaminergic neurons in midbrain cultures, without obvious effects on total neurons or glia and without increasing high-affinity GABA or serotonin reuptake. The purified protein exhibits an EC₅₀ in midbrain cultures at ∼40 pg/ml, or 1 p M , and has unique amino-terminal and internal amino acid sequences. The sequences provide a basis for cloning and expression of the gene for rat and human glial cell line-derived neurotrophic factor (GDNF), confirming that the protein purified as reported here is GDNF.     

Prevascularization of porous biodegradable polymers

Highly porous biocompatible and biodegradable polymers in the form of cylindrical disks of 13.5 mm diameter were implanted in the mesentery of male syngeneic Fischer rats for a period of 35 days to study the dynamics of tissue ingrowth and the extent of tissue vascularity, and to explore their potential use as substrates for cell transplantation. The advancing fibrovascular tissue was characterized from histological sections of harvested devices by image analysis techniques. The rate of tissue ingrowth increased as the porosity and/or the pore size of the implanted devices increased. The time required for the tissue to fill the device depended on the polymer crystallinity and was smaller for amorphous polymers. The vascularity of the advancing tissue was consistent with time and independent of the biomaterial composition and morphology. Poly(L-lactic acid) (PLLA) devices of 5 mm thickness, 24.5% crystallinity, 83% porosity, and 166 mum median pore diameter were filled by tissue after 25 days. However, the void volume of prevascularized devices (4%) was minimal and not practical for cell transplantation. In contrast, for amporphous PLLA devices of the same dimensions, and the similar porosity of 87% and median pore diameter of 179 mum, the tissue did not fill completely prevascularized devices, and an appreciable percentage (21%) of device volume was still available for cell engraftment after 25 days of implantation. These studies demonstrate the feasibility of creating vascularized templates of amorphous biodegradable polymers for the transplantation of isolated or encapsulated cell populations to regenerate metabolic organs and tissues. (c) 1993 John Wiley & Sons, Inc.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.