Substitution bias, rapid saturation, and the use of mtDNA for nematode systematics

Only relatively recently have researchers turned to molecular methods for nematode phylogeny reconstruction. Thus, we lack the extensive literature on evolutionary patterns and phylogenetic usefulness of different DNA regions for nematodes that exists for other taxa. Here, we examine the usefulness of mtDNA for nematode phylogeny reconstruction and provide data that can be used for a priori character weighting or for parameter specification in models of sequence evolution. We estimated the substitution pattern for the mitochondrial ND4 gene from intraspecific comparisons in four species of parasitic nematodes from the family Trichostrongylidae (38-50 sequences per species). The resulting pattern suggests a strong mutational bias toward A and T, and a lower transition/transversion ratio than is typically observed in other taxa. We also present information on the relative rates of substitution at first, second, and third codon positions and on relative rates of saturation of different types of substitutions in comparisons ranging from intraspecific to interordinal. Silent sites saturate extremely quickly, presumably owing to the substitution bias and, perhaps, to an accelerated mutation rate. Results emphasize the importance of using only the most closely related sequences in order to infer patterns of substitution accurately for nematodes or for other taxa having strongly composition-biased DNA. ND4 also shows high amino acid polymorphism at both the intra- and interspecific levels, and in higher level comparisons, there is evidence of saturation at variable amino acid sites. In general, we recommend using mtDNA coding genes only for phylogenetics of relatively closely related nematode species and, even then, using only nonsynonymous substitutions and the more conserved mitochondrial genes (e.g., cytochrome oxidases). On the other hand, the high substitution rate in genes such as ND4 should make them excellent for population genetics studies, identifying cryptic species, and resolving relationships among closely related congeners when other markers show insufficient variation.      

Identification of an alpha3-fucosyltransferase and a novel alpha2- fucosyltransferase activity in cercariae of the schistosome Trichobilharzia ocellata: biosynthesis of the Fucalpha1-->2Fucalpha1-- >3[Gal(NAc)beta1-->4]GlcNAc sequence

Fucose is a major constituent of the protein- and lipid-linked glycans of the various life-cycle stages of schistosomes. These fucosylated glycans are highly antigenic and seem to play a role in the pathology of schistosomiasis. In this article we describe the identification and characterization of two fucosyltransferases (FucTs) in cercariae of the avian schistosome Trichobilharzia ocellata, a GDP-Fuc:[Galbeta1-- >4]GlcNAcbeta-R alpha1-->3-FucT and a novel GDP-Fuc:Fucalpha-R alpha1-- >2-FucT. Triton X-100 extracts of cercariae were assayed for FucT activity using a variety of acceptor substrates. Type 1 chain (Galbeta1- ->3GlcNAc) based compounds were poor acceptors, whereas those based on a type 2 chain (Galbeta1-->4GlcNAc), whether alpha2'-fucosylated, alpha3'-sialylated, or unsubstituted, and whether present as oligosaccharide or contained in a glycopeptide or glycoprotein, all served as acceptor substrates. In this respect the schistosomal alpha3- FucT resembles human FucT V and VI rather than other known FucTs. N- ethylmaleimide, an inhibitor of several human FucTs, had no effect on the activity of the schistosomal alpha3-FucT, whereas GDP-beta-S was strongly inhibitory. Large scale incubations were carried out with Galbeta1-->4GlcNAc, GalNAcbeta1-->4GlcNAcbeta-O -(CH2)8COOCH3 and Fucalpha1-->3GlcNAcbeta1-->2Man as acceptor substrates and the products of the incubations were isolated using a sequence of chromatographic techniques. By methylation analysis and 2D-TOCSY and ROESY1H-NMR spectroscopy the products formed were shown to be Galbeta1-- >4[Fucalpha1-->2Fucalpha1-->3]GlcNAc, GalNAcbeta1-->4[Fucalpha1-- >2Fucalpha1-->3]GlcNAcbe ta-O-(CH2)8COOCH3, and Fucalpha1-->2Fucalpha1-- >3GlcNAcbeta1-->2Man, respectively. It is concluded that the alpha2- FucT and alpha3-FucT are involved in the biosynthesis of the (oligomeric) Lewisx sequences and the Fucalpha1-->2Fucalpha1-->3GlcNAc structural element that have been described on schistosomal glycoconjugates.      

Purification and Initial Characterization of Rat B49 Glial Cell Line-Derived Neurotrophic Factor

Abstract: The rat glial cell line B49 releases into its culture medium a potent neurotrophic factor that exhibits relative specificity for the dopaminergic neurons in dissociated cultures of rat embryonic midbrain. This factor is a heparin-binding, basic protein that is heterogeneously glycosylated and migrates on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and on molecular sieve chromatography with an apparent mass of ∼33–45 kDa. The factor behaves like a disulfide-bonded homodimer, whose biological activity is destroyed by reduction of disulfide bonds but not by SDS-PAGE or reversed-phase (RP)-HPLC. The apparent mass of the monomer is ∼16 kDa after deglycosylation with N-Glycanase. This factor has been purified 34,000-fold to apparent homogeneity by a combination of heparin-affinity chromatography, molecular sieving chromatography, SDS-PAGE, and RP-HPLC. The purified rat protein promotes the survival, morphological differentiation, and high-affinity dopamine reuptake of dopaminergic neurons in midbrain cultures, without obvious effects on total neurons or glia and without increasing high-affinity GABA or serotonin reuptake. The purified protein exhibits an EC₅₀ in midbrain cultures at ∼40 pg/ml, or 1 p M , and has unique amino-terminal and internal amino acid sequences. The sequences provide a basis for cloning and expression of the gene for rat and human glial cell line-derived neurotrophic factor (GDNF), confirming that the protein purified as reported here is GDNF.     

Prevascularization of porous biodegradable polymers

Highly porous biocompatible and biodegradable polymers in the form of cylindrical disks of 13.5 mm diameter were implanted in the mesentery of male syngeneic Fischer rats for a period of 35 days to study the dynamics of tissue ingrowth and the extent of tissue vascularity, and to explore their potential use as substrates for cell transplantation. The advancing fibrovascular tissue was characterized from histological sections of harvested devices by image analysis techniques. The rate of tissue ingrowth increased as the porosity and/or the pore size of the implanted devices increased. The time required for the tissue to fill the device depended on the polymer crystallinity and was smaller for amorphous polymers. The vascularity of the advancing tissue was consistent with time and independent of the biomaterial composition and morphology. Poly(L-lactic acid) (PLLA) devices of 5 mm thickness, 24.5% crystallinity, 83% porosity, and 166 mum median pore diameter were filled by tissue after 25 days. However, the void volume of prevascularized devices (4%) was minimal and not practical for cell transplantation. In contrast, for amporphous PLLA devices of the same dimensions, and the similar porosity of 87% and median pore diameter of 179 mum, the tissue did not fill completely prevascularized devices, and an appreciable percentage (21%) of device volume was still available for cell engraftment after 25 days of implantation. These studies demonstrate the feasibility of creating vascularized templates of amorphous biodegradable polymers for the transplantation of isolated or encapsulated cell populations to regenerate metabolic organs and tissues. (c) 1993 John Wiley & Sons, Inc.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Humpback whales (Megaptera novaeangliae) attend both Mexico and Hawaii breeding grounds in the same winter: mixing in the northeast Pacific

Humpback whales that assemble on winter breeding grounds in Mexico and Hawaii have been presumed to be, at least, seasonally isolated. Recently, these assemblies were declared Distinct Population Segments under the US Endangered Species Act. We report two humpback whales attending both breeding grounds in the same season—one moving from Hawaii to Mexico and the other from Mexico to Hawaii. The first was photo-identified in Maui, Hawaii on 23 February 2006 and again, after 53 days and 4545 km, on 17 April 2006 in the Revillagigedo Archipelago, Mexico. The second was photo-identified off Guerrero, Mexico on 16 February 2018 and again, 49 days and 5944 km later, on 6 April 2018 off Maui. The 2006 whale was identified in summer off Kodiak Island, Alaska; the 2018 whale off British Columbia. These Mexico–Hawaii identifications provide definitive evidence that whales in these two winter assemblies may mix during one winter season. This, combined with other lines of evidence on Mexico–Hawaii mixing, including interchange of individuals year to year, long-term similarity of everchanging songs, one earlier same-season travel record, and detection of humpback whales mid-ocean between these locations in winter, suggests reassessment of the ‘distinctiveness'' of these populations may be warranted.